Iris stenophylla

Hausskn. ex Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records8

Data sources11

Biological traits9

DNA specimens1

eDNA detections3

Sources11 archives

Databases and archives Iris stenophylla's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT10.7 Gbp

01Narrative

Iris stenophylla is a species of flowering plant in the genus Iris, it is also in the subgenus Scorpiris. It is a bulbous perennial.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris stenophylla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

matKFR870401.1 ↗1 690 bpTurkey

ACGT

CTAAATGGAAGAATTACAAGGATATTTAGAAAAGGATAGATCTAGGCAACAACCCCTCCTATATCCGCTTCTCTTTCAGGAGTATATTTA …

Iris stenophylla subsp. stenophylla chloroplast matK gene for maturase K and partial trnK gene intron, specimen voucher Chas11245

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Iris stenophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size10 721 325 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris stenophylla10.72 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidy2× diploid · measured

Chromosome records24–262n range25median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Hanson L, Leitch IJ, Bennett MD. Unpublished data from the Jodrell Laboratory, Royal Botanic Gardens, Kew

2n 262×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.240 ↗

08Occurrence & distribution

Record type8 records

Wild obs. + sensor2

Museum / vouchered3

Cultivated / captive3

Origin

Native3

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	2

1 institutions · 2 of 3 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Iris stenophylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter24.2 °C

Max temp (day)15.7 °C

Min temp (night)3.20 °C

Precipitation42.3 mm/mo

Air humidity54.3 %

Moisture balance-49.4 mm/mo

Vapour deficit708 Pa

Wind speed2.70 m/s

Cloud cover34.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)