Iris speculatrix

Hance · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records358

Data sources8

Biological traits13

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Iris speculatrix's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility358 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF358 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 44

01Narrative

Iris speculatrix is a beardless iris in the genus Iris, in the subgenus Limniris and in the series Chinenses of the genus. It is a rhizomatous herbaceous perennial, from Asia, found in China, Hong Kong and Taiwan. It has dark green, evergreen leaves, long slender stem and flowers in various blue shades, from violet, lilac, lavender, to light blue.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Fruit length52.5 mm

Fruit length max55 mm

Fruit length min50 mm

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris speculatrix has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJF942086.1 ↗636 bpChina

ACGT

CAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGAT …

Iris speculatrix voucher ZhouSL-xingan-Z081 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL5

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris speculatrix carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 444×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-atlas-flowering-plants +1

CCDB · ipcn-api-dl — Mao, J. q. & X. j. Xue. 1986. Chromosome numbers of thirteen iridaceous species from Zhejiang Province. Acta Agric. Univ. Zhejiang. 12: 99–101.

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.B. 1973. Cytogenetic studies in the genus Iris: Subsection Evansia, Benth. Cytologia 38: 501-514.

CCDB · book-atlas-flowering-plants — Snoad 1952

CCDB · Cave1959 — Lenz 1959

n 221×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.B. 1973. Cytogenetic studies in the genus Iris: Subsection Evansia, Benth. Cytologia 38: 501-514.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.887 ↗

08Occurrence & distribution

Record type358 records

Wild obs. + sensor87

Museum / vouchered271

Range

Area of Occupancy AOO632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 44≤1 km 9≤10 km 9>10 km 9

71 georeferenced · 16 without coordinates

Open the mapobservation + sensor87

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 271 records without

Open the institutions mapphysical evidence271

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	60
Guangzhou, CN	59
Kunming, CN	22
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	21
Nanjing, CN	18
Hangzhou, CN	16
Ischia Marine Centrelocation not on record	13
Zhejiang Universitylocation not on record	9
Guilin, CN	9
Shanghai, CN	5
Chengdu, CN	5
Xiamen, CN	5
Yangling, CN	5
Paris, FR	4
Zhuzhou, CN	4
HUFDlocation not on record	3
Guangzhou, CN	3
Zhejiang Museum of Natural Historylocation not on record	3
Wuhan, CN	2
Shanghai, CN	1
University of Stellenboschlocation not on record	1
Wellington, NZ	1
South Kensington, GB	1
Fort Worth, US	1

24 institutions · 271 of 271 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)