Iris sintenisii

Janka · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records262

Data sources8

Biological traits13

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Iris sintenisii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility262 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF262 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB3.9 Gbp

01Narrative

Iris sintenisii is a species in the genus Iris, it is also in the subgenus Limniris and in series Spuriae, with tall thin stems, violet-blue flowers and long grass-like leaves. It is a rhizomatous perennial plant, from grass meadows (including steppe) parts of Europe, Russia, and Turkey. It is cultivated as an ornamental plant in temperate regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass19.2 mg

Seed mass max19.2 mg

Seed mass min19.2 mg

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris sintenisii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLPQ191126.1 ↗1 341 bpUSA · 2016

ACGT

ATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAA …

Iris sintenisii voucher Iri043 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris sintenisii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 912 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris sintenisii3.91 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–202n range16median16mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · Cave1963

CCDB · fl-europaea — Popova

CCDB · ipcn-api-dl — POPOVA, M. & I. CESCHMEDJIEV. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.

CCDB · ipcn-api-dl — POPOVA, M. & I. CESCHMEDJIEV. 1976. Karyologic investigation of the genus Iris L. in Bulgaria. Phytologija (Sofia) 5: 57–65.

CCDB · ipcn-api-dl — Dalgiç, G. & C. Yarci. 1992. Trakya Bölgesi Iris L. Türleri. XI. Ulusal Biyoloji Kongresi (24--27 Haziran 1992, Elaziğ) Botanik 113--115.

CCDB · Cave1963 — Lenz & Day 1963

2n 202×CCDB · book-atlas-flowering-plants · CCDB · Cave1963

CCDB · book-atlas-flowering-plants

CCDB · Cave1963 — Lenz & Day 1963

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.759 ↗

08Occurrence & distribution

Record type262 records

Wild obs. + sensor213

Museum / vouchered44

Cultivated / captive5

Range

Area of Occupancy AOO840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 98≤1 km 52≤10 km 16>10 km 11

177 georeferenced · 36 without coordinates

Open the mapobservation + sensor213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence44

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 2 without coordinates

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	21
Paris, FR	11
LDlocation not on record	4
BRNUlocation not on record	2
Wlocation not on record	2
Oskarshamn, SE	1
BG-NMNHSlocation not on record	1
Auckland, NZ	1

8 institutions · 43 of 44 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)