Iris serotina — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records37

Data sources7

Biological traits9

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Iris serotina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF37 records

DNA & barcodingNCBIsequences

01Narrative

Iris serotina is a species in the genus Iris, it is also in the subgenus Xiphium. It is a bulbous perennial from southern Europe, found in Spain and Morocco.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris serotina has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLOP715662.1 ↗153 035 bp

ACGT

GCCTACTCTGGCTTTCGCGAGACATGCGAGAAACGATAAGAAATCTCGTCGTTAATTTTGAACGACGATCACAAATATTGGCAGGGGATC …

Iris serotina isolate Sero-13_S46_pla chloroplast, partial genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL1

plant barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor9

Museum / vouchered28

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 2

3 georeferenced · 6 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 2≤1 km 15≤10 km 7

24 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
València, ES	16
Paris, FR	3
Madrid, ES	2
Granada, ES	2
Museo Achille Folettolocation not on record	2
Alicante, ES	1
Wlocation not on record	1
Jaén, ES	1

8 institutions · 28 of 28 vouchered records shown