Iris scariosa

Willd. ex Link · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records188

Data sources10

Biological traits18

DNA specimens10

eDNA detections4

Sources10 archives

Databases and archives Iris scariosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility188 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF188 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Iris scariosa is a plant species in the genus Iris, it is also in the subgenus Iris. It is a rhizomatous perennial, from the mountainsides of Russia, Kazakhstan, Mongolia and China. It has sword-like, or sickle shaped, blue green or grey-green leaves, a short flowering stem, 3 or 4 membranous or semi-transparent flower bud leaves, 2 violet, reddish violet, lilac, blue-purple, or blue flowers in late spring, with yellow or white beards. It is cultivated as an ornamental plant in temperate regions. It was merged with another similar iris in the region, and Iris glaucescens became a synonym of Iris scariosa, before being divided into two separate species again. Although some sources still call it the main species, despite a slight colour difference.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length62.5 mm

Fruit length max75 mm

Fruit length min50 mm

Plant height max0.2 m

Plant height min0.1 m

Life cycle & reproduction5

Flowering endMay

Flowering startApr

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, saline places, steppe, stony places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris scariosa has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV900040.1 ↗508 bpChina · 2018

ACGT

GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCCGGCCGAGGGCACGCCTGCCTGGGCG …

Iris scariosa isolate XB_HM3033 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris scariosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · book-ipcn67-71 — ZAKHARYEVA O.I., & L.M. MAKUSHENKO. 1969. Chromosome numbers of monocotyledons belonging to the families Liliaceae, Iridaceae, Amaryllidaceae, Araceae. Bot. Zurn. 54: 1213-1227.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.254 ↗

08Occurrence & distribution

Record type188 records

Wild obs. + sensor115

Museum / vouchered73

Origin

Native5

Range

Area of Occupancy AOO488 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 46≤1 km 22≤10 km 9>10 km 7

84 georeferenced · 31 without coordinates

Open the mapobservation + sensor115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 6≤1 km 5≤10 km 4>10 km 10

25 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	13
Urumqi, CN	9
Moscow State Universitylocation not on record	9
Beijing, CN	5
Herbarium of South China Botanical Gardenlocation not on record	4
Kunming, CN	2
BRNUlocation not on record	2
Guangzhou, CN	2
Xining, CN	1
Nanjing, CN	1

10 institutions · 48 of 73 vouchered records shown · 25 without an institution code

09Environmental DNA4 detections

Where the DNA of Iris scariosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.3 °C 2.50–23.2

Seasonal swing summer↔winter29.2 °C

Max temp (day)16.4 °C 6.80–29.3

Min temp (night)4.50 °C -3.30–15.8

Precipitation62.1 mm/mo 7.70–102

Air humidity52.9 % 37.8–59.8

Moisture balance-66.1 mm/mo -156–-3.60

Vapour deficit921 Pa 295–1,634

Wind speed2.80 m/s 2.50–3.80

Cloud cover31.0 % 27.8–31.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)