Iris pseudopumila

Tineo · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records270

Data sources11

Biological traits9

DNA specimens1

eDNA detections0

Sources11 archives

Databases and archives Iris pseudopumila's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility270 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS22 compounds

Occurrence & distributionGBIF270 records

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Iris pseudopumila is a perennial plant with violet, purple, or yellow flowers, sometimes in combination. The beards are white, yellow, or bluish white. Native to southern Italy.Donald Wyman

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition22 compounds

Compounds documented for Iris pseudopumila across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Isoflavones10

Flavones10

Flavonols2

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxyphenyl)-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	LOTUS
5,7-dihydroxy-2-(4-hydroxyphenyl)-6-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
5-hydroxy-6,7-dimethoxy-3-[4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxyphenyl]chromen-4-one	present	LOTUS
5-hydroxy-7-methoxy-2-(4-methoxyphenyl)-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]chromen-4-one	present	LOTUS
7-Methyl-tectorigenin-4'-O-beta-D-glucopyranoside	present	LOTUS
9-methoxy-7-[4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-[1,3]dioxolo[4,5-g]chromen-8-one	present	LOTUS
Astragalin	present	LOTUS
Germanasim E	present	LOTUS
Iridin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris pseudopumila has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

matKMT294584.1 ↗2 572 bpItaly · 2018

ACGT

TCCCTCCCCAAACCGTGCTTGCATTTTTCATTGCACACGGCTTTCCCTATGTATACATATAAAAAAACTTACATACGGAGAAGAAAGTCT …

Iris pseudopumila pop variant PS2 tRNA-Lys (trnK) gene, intron; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris pseudopumila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–382n range16median16mode19records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1618×CCDB · ita-fl · CCDB · fl-europaea · CCDB · book-ipcn73-74 +3

CCDB · ita-fl — RANDOLPH L., MITRA J. - 1959. Karyotypes of Iris pumila and related species.. Amer. J. Bot. , 46: 93-102.

CCDB · ita-fl — COLASANTE M., RICCI I. - 1979. Iris pseudopumila Ten.: confronto citotassonomico tra esemplari provenienti da due diverse localit italiane.. Ann. Bot. (Rome) , 37: 261-269.

CCDB · ita-fl — MITRA J. - 1956. Karyotype analysis of bearded Iris.. Bot. Gaz. , 117(4): 265-293.

CCDB · ita-fl — GARBARI F., TORNADORE N., PECORI E. - 1973. Numeri cromosomici per la flora italiana:151-161.. Inform. Bot. Ital. , 5(2): 161-169.

CCDB · ita-fl — Colasante M. - 2003. Sulla diversit e sistematica del genere Iris L.. Inform. Bot. Ital. , 35(1): 198-207.

CCDB · fl-europaea — Simonet, 1955

CCDB · book-ipcn73-74 — GARBARI, F., N. TORNADORE, & E. PECOR!.. 1973. In Numeri cromosomici per la flora Italiana. Informatore Bot. Ital. s:-161-169.

CCDB · book-atlas-flowering-plants

CCDB · Cave1956 — Mitra

CCDB · Cave1959 — Rand. & Mitra 1959

2n 381×CCDB · iber-fl

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

n 83×CCDB · ita-fl

CCDB · ita-fl — MACCHIA F. - 1969. L'"Iris pseudopumila" Tin. nel Salento (Puglie) e la sua attuale area di distribuzione in Italia. Giorn. Bot. Ital. , 103(6): 619.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.745 ↗

08Occurrence & distribution

Record type270 records

Wild obs. + sensor241

Museum / vouchered29

Range

Area of Occupancy AOO528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 117≤1 km 74≤10 km 10>10 km 10

211 georeferenced · 30 without coordinates

Open the mapobservation + sensor241

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence29

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	24
Salamanca, ES	1
Paris, FR	1
Sevilla, ES	1
València, ES	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

6 institutions · 29 of 29 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)