Iris pseudocaucasica

Grossh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records21

Data sources8

Biological traits15

DNA specimens2

eDNA detections2

Sources8 archives

Databases and archives Iris pseudocaucasica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF21 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Iris pseudocaucasica is a species in the genus Iris, it is also in the subgenus Scorpiris. It is a bulbous perennial from central Asia, within the Caucasus (in Armenia, Azerbaijan and Georgia) and in Iran, Iraq and Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max0.1 m

Life cycle & reproduction5

Flowering endApr

Flowering startApr

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation min1 000 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTdry stony slopes

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris pseudocaucasica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

matKFR870394.1 ↗1 769 bpIran

ACGT

CTAAATGGAAGAATTACAAGGATATTTAGAAAAGGATAGATCTAGGCAACAACCCCTCCTATATCCGCTTCTCTTTCAGGAGTATATTTA …

Iris pseudocaucasica chloroplast matK gene for maturase K and partial trnK gene intron, specimen voucher Chase-11238

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5

plant barcode

08Occurrence & distribution

Record type21 records

Wild obs. + sensor8

Museum / vouchered9

Cultivated / captive4

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 5

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence9

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Wlocation not on record	4
Moscow State Universitylocation not on record	1
Mlocation not on record	1
M, VANFlocation not on record	1

4 institutions · 7 of 9 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Iris pseudocaucasica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 22.0–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C

Min temp (night)13.9 °C

Precipitation5.50 mm/mo

Air humidity39.8 %

Moisture balance-124 mm/mo

Vapour deficit1,940 Pa

Wind speed2.40 m/s

Cloud cover21.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)