Iris pseudacorus

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records651 181

Data sources17

Biological traits58

DNA specimens49

eDNA detections29

Sources17 archives

Databases and archives Iris pseudacorus's data was compiled from.

WikipediaWikimedia Foundation16 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility651 179 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics49 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements5 literature sources58 traits

Chemical compositionLOTUS · NPASS65 compounds

Occurrence & distributionGBIF · OBIS651 181 records

Environmental DNA1 datasets · 9 countries29 detections

DNA & barcodingBOLD · NCBI49 specimens

Genome at a glanceCCDB · GoaT5.9 Gbp

01Narrative

Iris pseudacorus, the yellow flag, yellow iris, or water flag, is a species of flowering plant in the family Iridaceae. It is native to Europe, western Asia and northwest Africa. Its specific epithet pseudacorus means "false acorus", referring to the similarity of its leaves to those of Acorus calamus (sweet flag), as they have a prominently veined mid-rib and sword-like shape. However, the two plants are not closely related. The flower is commonly attributed with the fleur-de-lis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsLEDATRYWCVP

Size & morphology20

Fruit length50 mm

Fruit width20 mm

Leaf length850 mm

Leaf length max1 000 mm

Leaf length min700 mm

Leaf mass1 507 mg

Leaf size31 623 mm²

⚠ sources differ — TRY: 31 623 mm² · LEDA: 21 318 mm² · GIFT: 20 874 mm²

Leaf width25 mm

⚠ sources differ — AusTraits: 25 mm · GIFT: 3 mm

Leaf width max30 mm

Leaf width min20 mm

Plant height0.625 m

⚠ sources differ — GIFT: 0.625 m · AusTraits: 1.18 m · LEDA: 0.75 m · TRY: 1.15 m

Plant height generative0.9 m

Plant height max1.6 m

Plant height min0.4 m

Seed length6.81 mm

Seed length max7 mm

Seed length min7 mm

Seed mass45.52 mg

Seed mass max56 mg

Seed mass min37.97 mg

Life cycle & reproduction13

Deciduousnessdeciduous

⚠ sources differ — TRY: deciduous · GIFT: evergreen

Dehiscencedehiscent

Dispersal typewater

Flowering endJul

Flowering startMay

Life formrhizomatous geophyte or helophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualabsent

Seed number60

Self fertilizationabsent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphyteterrestrial

Fruit typecapsule

Growth formherb

Habitat GIFTlakes, rivers, shores, swamps

Leaf shapeensiform

Mycorrhizaabsent

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry9

Leaf C:N ratio36.72 g/g

Leaf c395 mg/g

Leaf dry-matter content (LDMC)243 mg/g

⚠ sources differ — TRY: 243 mg/g · LEDA: 173 mg/g

Leaf n12.68 mg/g

Leaf p2.11 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Seed longevity index0

Specific leaf area (SLA)18.42 mm²/mg

⚠ sources differ — TRY: 18.42 mm²/mg · LEDA: 15.95 mm²/mg · GIFT: 16.05 mm²/mg

Other traits1

Diaspore typeone-seeded generative dispersule

03Chemical composition65 compounds

Compounds documented for Iris pseudacorus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoflavones13

Catechols with side chains7

Coumaronochromones7

Aromatic polyketides with side chains6

Acyclic triterpenoids4

Documented compounds65 total

Compound	Amount	Source
(1S)-4-[(1E,3E,5E,7E,9E,11E,13E,15E,17E)-18-[(1R,4S)-4-hydroxy-2,6,6-trimethylcyclohex-2-en-1-yl]-3,7,12,16-tetramethyloctadeca-1,3,5,7,9,11,13,15,17-nonaenyl]-3,5,5-trimethylcyclohex-3-en-1-ol	present	LOTUS
(2R)-5,7-dihydroxy-2-(2-hydroxyphenyl)-2,3-dihydrochromen-4-one	present	LOTUS
(2R,3R)-Alpinone	present	LOTUS
(2S,3R)-3,5-dihydroxy-2-(4-hydroxyphenyl)-7-methoxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S,3R)-3,5-dihydroxy-7-methoxy-2-phenyl-2,3-dihydrochromen-4-one	present	LOTUS
(2Z)-2-[(1S,3S,5R,6S,10R)-1,6-dihydroxy-10-(3-hydroxypropyl)-6-methyl-3-[(1E,3E,5E)-2,6,10-trimethylundeca-1,3,5,9-tetraenyl]-2-oxaspiro[4.5]decan-9-ylidene]propanal	present	LOTUS
(2Z)-2-[(2S,3R,4R)-2-(3-hydroxypropyl)-3,4-dimethyl-3-[(3E,6E,8S)-4,8,12-trimethyltrideca-3,6,11-trienyl]cyclohexylidene]propan-1-ol	present	LOTUS
(2Z)-2-[(2S,3R,4R)-2-(3-hydroxypropyl)-3,4-dimethyl-3-[(3E,7E)-4,8,12-trimethyltrideca-3,7,11-trienyl]cyclohexylidene]propanal	present	LOTUS
(2Z)-2-[(3R,5S,6R,10S)-10-hydroxy-6-(3-hydroxypropyl)-10-methyl-3-[(1E,3E,5E)-2,6,10-trimethylundeca-1,3,5,9-tetraenyl]-2-oxaspiro[4.5]decan-7-ylidene]propanal	present	LOTUS
(2Z)-2-[(3S,4S,5S,6R,10S)-4,10-dihydroxy-3-[(3E,5Z)-6-(hydroxymethyl)-10-methylundeca-1,3,5,9-tetraen-2-yl]-6-(3-hydroxypropyl)-10-methylspiro[4.5]decan-7-ylidene]propanal	present	LOTUS

05DNA & barcoding49 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris pseudacorus has left across the world's sequence archives.

At a glance

DNA specimens49

Marker genes6

GenBank sequences10

eDNA detections29

Countries10

The DNA barcodea real sequence read deposited for this species

ITSLC757754.1 ↗369 bpJapan · 2022

ACGT

TGCAGAATCCCTTGAACCATCGAGTCTTTGAGCGCAAGTTACGATCGAGGCATTCTGGTCGAGTTCATACATGTCTGGGCGTCACGCCTC …

Iris pseudacorus MAFF_014 genes for 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PmatK3rbcL4rbcLaITS3ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Iris pseudacorus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 936 460 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris pseudacorus5.94 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records24–402n range34median34mode99records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3471×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +13

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ita-fl — DYER A.F., ELLIS T.H.N., LITHGOW E., LOWTHERS S., MASON I., WILLIAMS D. - 1976. The caryotype of Iris pseudacorus L.. Trans. Bot. Soc. Edinburgh. , 42(4): 421-429.

CCDB · ita-fl — MORI M. - 1957. Note brevi. Il numero cromosomico diploide di alcune specie di angiosperme raccolte nella tenuta di S. Rossore (Pisa).. Caryologia , 9(2): 365-368.

CCDB · slov-fl — Králik E., 1986: Karyological study of the Slovakian flora XVI. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 77-80.

CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · brit-fl — Jones, K. (1969)

CCDB · brit-fl — Dyer, A.F., Ellis, T.H.N., Lithgow, E., Lowther, S., Mason, I., Williams, D. Trans. & Proc. Bot. Soc. Edinburgh 42: 421-429 (1976)

CCDB · iber-fl — Contribucin al estudio cariolgico de la familia Iridaceae en Andalucia Occidental. Prez, E. & J. Pastor.Lagascalia17(2): 257-272(1994).

CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).

CCDB · iber-fl — Herborizaoes nos domnios da fundaao da Casa de Bragana. I-Vendas Novas. Fernandes, A., J. Garcia & R. Fernandes.Mem. Soc. Brot.4: 5-89(1948).

CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 1-34. Valds Bermejo, E.Anales Jard. Bot. Madrid36: 373-389(1980).

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4854

CCDB · fl-europaea — Felfoldy, 1947

CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.

CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.

CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.

CCDB · ipcn-api-dl — Mao, J. q. & X. j. Xue. 1986. Chromosome numbers of thirteen iridaceous species from Zhejiang Province. Acta Agric. Univ. Zhejiang. 12: 99–101.

CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.

CCDB · ipcn-api-dl — Laublin, G. & M. Cappadocia. 1992. In vitro ovary culture of some Apogon garden irises (Iris pseudacorus L., I. setosa Pall., I. versicolor L.). Bot. Acta 105: 319–322.

CCDB · ipcn-api-dl — Králik, E. 1986. Karyological study of the Slovak flora XVI. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 77–80.

CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.

CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.

CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.

CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.

CCDB · ipcn-api-dl — Valdes-Bermejo, E. 1980. Numeros cromosomaticos de plantas occidentales. 1-34. Anales Jard. Bot. Madrid 36: 373–389.

CCDB · ipcn-api-dl — Murin, A. 1974. In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.

CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.

CCDB · ipcn-api-dl — Uhrikova, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.

CCDB · ipcn-api-dl — Dyer, A. F. 1976. The karyotype of Iris pseudacorus L. Trans. Bot. Soc. Edinburgh 42: 421–429.

CCDB · ipcn-api-dl — Dalgiç, G. & C. Yarci. 1992. Trakya Bölgesi Iris L. Türleri. XI. Ulusal Biyoloji Kongresi (24--27 Haziran 1992, Elaziğ) Botanik 113--115.

CCDB · book-ipcn75-78 — Uhrikova 1978

CCDB · book-ipcn75-78 — Dyer et al. 1976

CCDB · book-ipcn75-78 — Murin 1974

CCDB · book-ipcn75-78 — Murin 1978

CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.

CCDB · eflora

CCDB · Cave1957 — Mori

+28 more references

2n 2417×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +5

GoaT · DTOL Flowering Plants Estimates Kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.

CCDB · fl-europaea — Majovsky et al.

CCDB · poland — Skali?ska M., Banach-Pogan E., Wcis?o H. et al. 1957. Further studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 26, 215-246.

CCDB · ipcn-api-dl — Natarajan, G. 1979. Etude caryosystematique de quelques monocotyledones de la garrigue Languedocienne. Nat. Monspel., Sér. Bot. 30: 1–27.

CCDB · ipcn-api-dl — Natarajan, G. 1979a. In IOPB chromosoJne number reports LXV. Taxon 28: 629.

CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213

CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.

CCDB · CromoCat 2015 — Garajová, S. (1959). Príspevok k cytologickym pomerom flóry okolia Bratislava Tesis Bratislava

CCDB · CromoCat 2015 — Longley, A. E. (1928). Chromosomes in Iris species. Bull. Amer. Iris Soc. 29: 43-55.

CCDB · CromoCat 2015 — Miyake, K. (1905). Uber Reduktionsteilung in den Pollenmutterzellen einiger Monokotylen. III. Jahrb. Wiss. Bot. 42: 83-120.

CCDB · CromoCat 2015 — Natarajan, G. (1979a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 629.

CCDB · CromoCat 2015 — Natarajan, G. (1979b). Étude caryosystématique de quelques Monocotyledones de la garrigue Languedocienne. Nat. Monsp. Bot. 30: 1-27.

CCDB · CromoCat 2015 — Pólya, L. (1949). Chromosome numbers of some Hungarian plants. Acta Geobot. Hung. 6: 124-137.

CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc

CCDB · CromoCat 2015 — Strasburger, E. (1900). Über reduktionsteilung, spindelbildung, centrosomen und cilienbilder in pflanzenreich. Histol. Beitr. 6: 1-224.

2n 327×CCDB · fl-europaea · CCDB · poland · CCDB · ipcn-api-dl +3

CCDB · fl-europaea — Lovka et al.,

CCDB · poland — Skali?ska M., Piotrowicz M., Soko?owska-Kulczycka A. et al. 1961. Further additions to chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 30, 463-489.

CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. & J. Mĕsíček. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.

CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-

CCDB · book-ipcn75-78 — Popova & Ceshmedjiev 1976

CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIV]. Taxon 20(5/6): 788-791.

CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.

2n 303×CCDB · brit-fl · CCDB · fl-europaea · CCDB · CromoCat 2015

CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)

CCDB · fl-europaea — Polya, 1949

CCDB · CromoCat 2015 — Pólya, L. (1949). Chromosome numbers of some Hungarian plants. Acta Geobot. Hung. 6: 124-137.

2n 401×CCDB · fl-europaea

CCDB · fl-europaea — Mori, 1957

n 172×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015

CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.

CCDB · CromoCat 2015 — Laane, M. M. (1971). Chromosome numbers in Norwegian vascular plant species 6. Blyttia 29: 229-234.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

07Deep time~13.1 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin13.1 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Dietphotoautotroph

08Occurrence & distribution

Record type651 181 records

Wild obs. + sensor635 543

Museum / vouchered10 932

Cultivated / captive45

Fossil6

Other4 655

Origin

Native32 287

Introduced196

Range

Area of Occupancy AOO571 656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 149 748≤1 km 104 818≤10 km 258 772>10 km 3 655

516 993 georeferenced · 118 550 without coordinates

Open the mapobservation + sensor635 543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 523≤1 km 2 271≤10 km 4 773>10 km 638

8 205 georeferenced · 2 727 without coordinates

Open the institutions mapphysical evidence10 932

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 12

12 georeferenced · 33 without coordinates

Open the mapnot free-living45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions184 of 316 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	5 117
Helsinki, FI	427
BFLlocation not on record	289
Olocation not on record	222
Moscow State Universitylocation not on record	220
LDlocation not on record	217
Paris, FR	139
Uppsala, SE	134
Trondheim, NO	117
Salzburg, AT	112
Oulu, FI	109
Oskarshamn, SE	89
Odawara, JP	85
Turku, FI	82
Kuopio, FI	76
Bergen, NO	76
MeiseBGlocation not on record	71
Fukushima Universitylocation not on record	69
Uniwersytet Warszawskilocation not on record	69
Tartu, EE	67
LfUlocation not on record	65
WTUlocation not on record	63
Jyväskylä, FI	60
KMNlocation not on record	59
TROMlocation not on record	57
Oregon State Universitylocation not on record	56
Christchurch, NZ	51
SLU Artdatabankenlocation not on record	51
Bronx, US	49
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	47
Madison, US	47
South Kensington, GB	43
TUR-Alocation not on record	40
Chongqing Museumlocation not on record	38
Vitebsk State University named after P.M. Masherovlocation not on record	36
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	34
Provincia di Livornolocation not on record	31
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	31
Tsukuba, JP	30
Tallinn, EE	30
Bando, JP	30
BDBClocation not on record	28
Nagano City, JP	27
Kochi, JP	27
Ann Arbor, US	26
National Institute of Biological Resourceslocation not on record	25
Victoria, CA	24
Allentown, US	24
Görlitz, DE	23
MAlocation not on record	22
Corvallis, US	22
Tacoma, US	21
Philadelphia, US	21
Wuzhou, CN	20
Auckland, NZ	20
Chiba, JP	19
St. Paul, US	19
Vitoria, ES	19
Pullman, US	19
San Sebastián, ES	18
Berlin, DE	18
Adam Mickiewicz University in Poznańlocation not on record	18
Adelaide, AU	18
Pretoria, ZA	17
Barcelona, ES	17
Burlington, US	17
Williamsburg, US	17
Bern, CH	17
Sanda, JP	17
Canadian Department of Agriculturelocation not on record	17
Hiratsuka City Museumlocation not on record	16
College Park, US	16
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	16
University of Stellenboschlocation not on record	15
UGentlocation not on record	15
Museum of the Rockieslocation not on record	14
McWane Science Centerlocation not on record	14
Durban, ZA	13
ISAlocation not on record	13
Porvoo, FI	13
Frankfurt am Main	13
University of New Hampshirelocation not on record	12
Porrentruy, CH	12
Green Bay, US	12
Chicago, US	11
New Haven, US	11
Riverside, US	11
Tomioka, JP	11
Université Lavallocation not on record	11
Claremont, US	10
Dresden, DE	10
Acadia Universitylocation not on record	10
Millersville, US	9
BRNUlocation not on record	9
CJBGlocation not on record	9
Toyama, JP	8
Chadron, US	8
Karlsruhe, DE	8
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	8
Institut und Museum fuer Geologie und Palaeontologielocation not on record	8
Shinshu Universitylocation not on record	8
Moscow, US	8
Missoula, US	8
Natural History Museum Rotterdamlocation not on record	8
Vancouver, CA	7
Otaru, JP	7
Boise, US	7
Madrid, ES	7
University of Wisconsinlocation not on record	7
Toronto, CA	7
València, ES	7
Wlocation not on record	7
San Luis Obispo, US	7
Denver, US	6
KIRMlocation not on record	6
Sagamihara, JP	6
Montréal, CA	6
Morgantown, US	6
Tokushima, JP	6
Saint Louis, US	6
San Jose State University, Museum of Birds and Mammalslocation not on record	6
Canberra, AU	6
Entomological Society of Latvialocation not on record	6
Santa Barbara, US	6
GJOlocation not on record	5
Chicago, US	5
Wellington, NZ	5
Mount Annan, AU	5
Museo Entomologico de Leonlocation not on record	5
BSBIlocation not on record	5
Tilburg, NL	5
Forssa, FI	5
Frauenfeld, CH	5
Austin, US	5
Bloomington, US	5
Johnson City, US	5
Ciudad de México, MX	5
Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record	5
Davis, US	4
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Jena Microbial Resource Collectionlocation not on record	4
KURAlocation not on record	4
Mlocation not on record	4
Hudson, US	4
Flagstaff, US	4
Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record	4
Fayetteville, US	4
Jackson, US	4
Winterthur, CH	4
Bozeman, US	4
Bangkok, TH	4
University of Alberta Museumslocation not on record	4
US	4
Córdoba, AR	4
Uniwersytet Opolskilocation not on record	4
SZUlocation not on record	4
Angwin, US	4
San Diego, US	4
Kawasaki Shi Tama Ku, JP	4
BAYLUlocation not on record	4
Portland, US	4
Norfolk, US	3
Tuscaloosa, US	3
Uniwersytet Śląski w Katowicachlocation not on record	3
Alicante, ES	3
Hobart, AU	3
Bend, US	3
Keene State Universitylocation not on record	3
Rovaniemi, FI	3
Hokkaido University Museumlocation not on record	3
University of Southern Mississippilocation not on record	3
CASlocation not on record	3
Universidad del Pais Vasco (UPV/EHU)location not on record	3
Chapel Hill, US	3
Caldwell, US	3
Albuquerque, US	3
Beijing, CN	3
GZUlocation not on record	3
Rotorua, NZ	3
Museo della Bonifica di San Donà di Piavelocation not on record	3
Bourges, FR	3
DOI/NPS, Colonial National Historical Parklocation not on record	3
Tromso University Museumlocation not on record	3
Museo Achille Folettolocation not on record	3
Conservatoire botanique national du Bassin parisienlocation not on record	3
Pamplona, ES	3
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	3
Pamplona, ES	3
Glarus, CH	3
Dekalb, US	2
Québec, CA	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Chicago, US	2
James F. Matthews Center for Biodiversity Studieslocation not on record	2
Xiamen, CN	2
Naturalis Biodiversity Centerlocation not on record	2
FLADlocation not on record	2
Oswego, US	2
International Salmonella Centre (W.H.O.)location not on record	2
National Museum Waleslocation not on record	2
Banyoles, ES	2
Emporia, US	2
Ivano-Frankove, UA	2
Henderson, US	2
Prioksko-Terrasnyi Biosphere Reservelocation not on record	2
Kew, GB	2
Irvine, US	2
Nagatoro-machi, Chichibu-gun, JP	2
Parkville, AU	2
Lincoln, US	2
Rishon Le Zion, IL	2
Denton, US	2
Logan, US	2
Ishikawa Museum of Natural Historylocation not on record	2
Osaka, JP	2
BClocation not on record	2
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	2
Santiago de Compostela, ES	2
Kushiro City Museumlocation not on record	2
Nishihara, JP	2
Royal Botanic Garden Edinburghlocation not on record	2
Edinburgh, GB	2
Durham, US	2
Guangzhou, CN	2
Minia, EG	2
Lord Fairfax Community Collegelocation not on record	2
DASSHlocation not on record	2
Fort Worth, US	2
University of Guelph, OAC Herbariumlocation not on record	2
Badajoz, ES	2
Davenport, US	2
Clemson, US	2
Little Rock, US	2
H-Dunkellocation not on record	2
PrivatHerblocation not on record	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	2
Columbia, US	1
Salamanca, ES	1
J.F.Oberlin Universitylocation not on record	1
University of North Carolina at Pembrokelocation not on record	1
Tampa, US	1
National Botanic Garden of Waleslocation not on record	1
University of British Columbialocation not on record	1
San Diego Natural History Museum, Herbariumlocation not on record	1
Provo, US	1
Nishihara, JP	1
Iwate Prefectural Museumlocation not on record	1
Pacific Lutheran Universitylocation not on record	1
IPE-CSIClocation not on record	1
Pocatello, US	1
Musee des Dinosaures d'Esperaza (Aude)location not on record	1
Zürich, CH	1
Mount Pleasant, US	1
NMBU:MINAlocation not on record	1
Kagoshima, JP	1
Turlock, US	1
US	1
Weber State Universitylocation not on record	1
Herbario Universidad de Concepciónlocation not on record	1
Knoxville, US	1
nbflocation not on record	1
Metsähallituslocation not on record	1
GAlocation not on record	1
Finnish Museum of Natural History, Botanical Museumlocation not on record	1
Hamilton, US	1
Tennessee Technological Universitylocation not on record	1
Philadelphia, US	1
Portland, US	1
UnBlocation not on record	1
US	1
Cape Town, ZA	1
JP	1
HUN003location not on record	1
Phoenix, US	1
AUT001location not on record	1
Córdoba, ES	1
Long Beach, US	1
Sendai, JP	1
Los Angeles, US	1
SNSNMClocation not on record	1
AUAlocation not on record	1
Central Botanical Gardenlocation not on record	1
Durango, US	1
ULBF-AGRlocation not on record	1
Garðabær, IS	1
Fairfax, US	1
Tulane Universitylocation not on record	1
Tula State Universitylocation not on record	1
Lausanne, CH	1
University of British Columbia, Herbariumlocation not on record	1
DULlocation not on record	1
PRClocation not on record	1
Montréal, CA	1
Saint John, CA	1
Jaén, ES	1
Musée des Confluenceslocation not on record	1
Coimbra, PT	1
EEZA-CSIClocation not on record	1
Monastir, TN	1
Royal Botanical Gardenslocation not on record	1
Tampere, FI	1
Namur, BE	1
DBF-NHMDlocation not on record	1
JBCLMlocation not on record	1
Richmond, US	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Mohonk Preservelocation not on record	1
Akita Prefectural Museumlocation not on record	1
OLAlocation not on record	1
UEMAlocation not on record	1
Alexandria Universitylocation not on record	1
RJBJCIlocation not on record	1
Durango, MX	1
Batemans Bay, AU	1
Göteborg, SE	1
Dover, US	1

316 institutions · 10 259 of 10 932 vouchered records shown · 582 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA29 detections

Where the DNA of Iris pseudacorus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries9

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map9 countries0

Tidal marsh,fresh water

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 12.4–17.9

Seasonal swing summer↔winter13.9 °C

Max temp (day)17.2 °C 14.8–23.1

Min temp (night)11.0 °C 9.10–14.1

Precipitation81.8 mm/mo 56.2–121

Air humidity62.4 % 58.0–65.0

Moisture balance-20.6 mm/mo

Vapour deficit617 Pa 514–868

Wind speed4.00 m/s

Cloud cover43.3 % 37.9–64.2

CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources17 archives

Size & morphology20

Life cycle & reproduction13

Diet & foraging2

Habitat & environment13

Physiology & chemistry9

Other traits1

Compound class profile5 classes

Documented compounds65 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

How it livedPBDB

Record type651 181 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions184 of 316 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type651 181 records