Iris planifolia

(Mill.) T.Durand & Schinz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records1 895

Data sources9

Biological traits11

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Iris planifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 895 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF1 895 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Iris planifolia — вид растений рода Ирис семейства Ирисовые.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Seed mass35.97 mg

Life cycle & reproduction2

Life formbulbous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris planifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMT806741.1 ↗488 bpSpain · 2020

ACGT

CCGATTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCTGCTGAAGAAGCGGGGGCCGCGG …

Iris planifolia voucher 2020-IESJC1-BACH-VG ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris planifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–482n range24median24mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2415×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +4

CCDB · ita-fl — SCRUGLI A. - 1982. Numeri cromosomici per la flora italiana:868-872.. Inform. Bot. Ital. , 14(2-3): 229-233.

CCDB · ita-fl — COLASANTE M., VOSA C.G. - 1981. The cytotaxonomic relationship between Iris palestina Boiss. and I. alata Poir.. Caryologia , 34(2): 207-212.

CCDB · ita-fl — RICCI I. - 1973 (1970-71). Cariotipo di Iris planifolia (Mill.) Dum. et Schinz.. Ann. Bot. (Rome) , 30: 215-221.

CCDB · ita-fl — GARBARI F., TORNADORE N. - 1972. Numeri cromosomici per la flora italiana:108-123.. Inform. Bot. Ital. , 4(1): 60-66.

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · iber-fl — IOPB. Chromosome number reports. XLVI. Fernndez Morales, M. J.Taxon23(5/6): 805(1974).

CCDB · iber-fl — Contribucin al estudio cariolgico de la familia Iridaceae en Andalucia Occidental. Prez, E. & J. Pastor.Lagascalia17(2): 257-272(1994).

CCDB · fl-europaea — Garbari &

CCDB · ipcn-api-dl — Colasante, M. & C. G. Vosa. 1981. The cytotaxonomic relationship between Iris palestina Boiss. and Iris alata Poir. Caryologia 34: 207–212.

CCDB · ipcn-api-dl — Scrugli, A. 1982. Numeri cromosomici per la Flora Italiana: 868-872. Inform. Bot. Ital. 14: 229–233.

CCDB · book-ipcn72 — GARBARI, F . & N TORNADORE. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot.--Ytal. 4: 45-66.

CCDB · book-ipcn73-74 — RICCI, I. 1970-71. Cariotipo di Iris planifloia (Mill.) Our. et Schinz. Ann. Bot. (Rome) 30: 215-221.

CCDB · book-ipcn73-74 — RUIZ REJON, M. In IOPB chromosome number reports XLVI. Taxon 23: 801- 812.

CCDB · book-atlas-flowering-plants

2n 481×CCDB · ita-fl

CCDB · ita-fl — AQUARO G., PERUZZI L., CESCA G. - 2004. Numeri cromosomici per la Flora Italiana 1446-1454. Inform. Bot. Ital. , 36(2): 419-424.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.240 ↗

08Occurrence & distribution

Record type1 895 records

Wild obs. + sensor1 838

Museum / vouchered57

Origin

Native43

Range

Area of Occupancy AOO3 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 902≤1 km 137≤10 km 72>10 km 70

1 181 georeferenced · 657 without coordinates

Open the mapobservation + sensor1 838

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 2≤1 km 6≤10 km 1

9 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MAlocation not on record	36
Paris, FR	5
Jaén, ES	5
San Jose State University, Museum of Birds and Mammalslocation not on record	3
Wlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Banyoles, ES	1
Auckland, NZ	1
Granada, ES	1

9 institutions · 56 of 57 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Iris planifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 14.5–14.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C

Min temp (night)9.30 °C

Precipitation72.2 mm/mo

Air humidity58.3 %

Moisture balance-20.6 mm/mo

Vapour deficit782 Pa

Wind speed2.60 m/s

Cloud cover40.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris planifolia

At a glance

Sources9 archives

Size & morphology1

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 895 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 895 records