Iris nigricans

Dinsm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records28

Data sources13

Biological traits13

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Iris nigricans's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Iris nigricans is a flowering plant in the family Iridaceae. It is the national flower of Jordan. The flowers are blackish-purple and 12 - in diameter, and the plants are 35 cm tall with recurved leaves. It needs direct sun and sharp drainage.http://www.rareplants.co.uk/product.asp?P_ID=3080 It is endemic to Jordan and is an endangered species. There are 8 other irises native to Jordan, and most of these are also endangered. The black species are sometimes confused with Iris nigricans. Iris vartanii - Vartanii Iris - light blue flowers - extinct in Jordan Iris atrofusca - Jil'ad Iris - black flowers - endangered Iris atropurpurea - Purple Iris - black flowers - cultivated but vulnerable in the wild Iris petrana - Petra Iris - black flowers Iris germanica - German Iris - purple flowers Iris postii - Post Iris - purple flowers Iris edomensis - Edom iris - white flowers with black spots - endangered Iris aucheri - Desert Iris - various colors

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass61.8 mg

Seed mass max61.8 mg

Seed mass min61.8 mg

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition17 compounds

Compounds documented for Iris nigricans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Plant xanthones5

Methyl xanthones $ Plant xanthones3

Methyl xanthones2

Isoflavones2

Disaccharides1

Documented compounds17 total

Tissue Source Quantified only

Compound	Amount	Source
1,3,8-Trihydroxy-7-methoxyxanthone	present	LOTUS
1,4,5,7-tetrahydroxy-6-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]xanthen-9-one	present	LOTUS
1,6-Dihydroxy-3,7-dimethoxyxanthone	present	LOTUS
9H-Xanthen-9-one, 2-beta-D-glucopyranosyl-1,3,6-trihydroxy-7-methoxy-	present	LOTUS
Acetovanillone	present	LOTUS
AHQSISRIGWKDQV-ZHHJOTBYSA-N	present	NPASS
Bellidifolin	present	LOTUS
beta-Sitosterol	present	LOTUS
Demethylbellidifolin	present	LOTUS
Irilone	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris nigricans has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMW476741.1 ↗153 190 bpJordan · 2000

ACGT

CCCGATATCTTACTAAAACAAGATATCGGGCATGGATCCTTCAACGATTCGTATACATTAATACGGAAATCTTATCCATTTATAGATGGA …

Iris nigricans chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris nigricans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 201×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Avishai, M. & D. ZOHARY. 1977. Chromosomes in the Oncocylus Irises. Bot. Gaz. 138: 5 502–5 1 1.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.256 ↗

08Occurrence & distribution

Record type28 records

Wild obs. + sensor22

Museum / vouchered6

Range

Area of Occupancy AOO88 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤1 km 2>10 km 14

16 georeferenced · 6 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	5
Wlocation not on record	1

2 institutions · 6 of 6 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Iris nigricans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)