Iris milesii

Baker ex Foster · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records53

Data sources11

Biological traits16

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Iris milesii's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility53 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF53 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Iris milesii (also known as the red flower iris) is a plant species in the genus Iris, subgenus Limniris and in the section Lophiris (crested irises). It is a rhizomatous, beardless perennial plant, native to the Himalayas, India and China. It has pinkish-violet, or pinkish purple, or pinkish-lavender or pinkish lilac flowers, with a fringed yellow or orange crest (or ridge). It is cultivated as an ornamental plant in temperate regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass23.13 mg

Seed mass max23.13 mg

Seed mass min23.13 mg

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max3 500 m

Elevation min1 470 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition13 compounds

Compounds documented for Iris milesii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Isoflavones8

Cinnamic acids and derivatives3

Flavonols1

Benzoquinones1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
2,6-Dimethoxy-1,4-benzoquinone	present	LOTUS
2-(3,4-Dihydroxyphenyl)-6,8-dihydroxy-3-methoxychromen-4-one	present	LOTUS
5,6,7,4'-Tetrahydroxy-3'-methoxyisoflavone	present	LOTUS
5,6,7,4'-Tetrahydroxy-8-methoxyisoflavone	present	LOTUS
Iridin	present	LOTUS
Irigenin	present	LOTUS
Iristectorigenin A 7-glucoside	present	LOTUS
methyl (E)-3-[3-methoxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]prop-2-enoate	present	LOTUS
Methyl Ferulate	present	LOTUS
Prunetin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris milesii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences6

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLPQ191123.1 ↗1 341 bpSouth Korea · 2016

ACGT

ATGTCACCACAAACAGAAACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAA …

Iris milesii voucher Iri042 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris milesii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–262n range26median26mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 264×CCDB · book-ipcn73-74 · CCDB · book-indian_vol2 · CCDB · eflora +1

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.B. 1973. Cytogenetic studies in the genus Iris: Subsection Evansia, Benth. Cytologia 38: 501-514.

CCDB · book-indian_vol2 — Simonet, M. 1932b, 1934a ; Chimp- hamba, B.M. 1973a

CCDB · eflora

CCDB · book-atlas-flowering-plants — Simonet 1934a

n 131×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.B. 1973. Cytogenetic studies in the genus Iris: Subsection Evansia, Benth. Cytologia 38: 501-514.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.053 ↗

08Occurrence & distribution

Record type53 records

Wild obs. + sensor21

Museum / vouchered28

Cultivated / captive3

Other1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 4≤10 km 4

12 georeferenced · 9 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence28

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	17
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
GMBAlocation not on record	2
Paris, FR	1
Beijing, CN	1
Vancouver, CA	1
University of Stellenboschlocation not on record	1
MeiseBGlocation not on record	1
Dehra Dun, IN	1

9 institutions · 27 of 28 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Iris milesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C

Min temp (night)19.3 °C

Precipitation109 mm/mo

Air humidity52.0 %

Moisture balance-17.8 mm/mo

Vapour deficit1,616 Pa

Wind speed1.80 m/s

Cloud cover25.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)