Iris macrosiphon

Torr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records2 994

Data sources12

Biological traits10

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Iris macrosiphon's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 994 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF2 994 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT · NCBI≈4.3 Gbp

01Narrative

Iris macrosiphon, the bowltube iris, is a flowering plant in the iris family, endemic to California in the Cascade Range Foothills, north and central Sierra Nevada Foothills, Inner North Coast Ranges, and San Francisco Bay Area, where it occurs in sunny grasslands, meadows, and open woodlands. The leaves are very slender, 2.5–5 mm wide, and blue-green in color. The flower is variable, golden yellow to cream or pale lavender to deep blue-purple, generally with darker veins. The flower stems are usually short (less than 25 cm) when in the sun and bear 2 flowers. It blooms in spring.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris macrosiphon has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAF488753.1 ↗644 bp

ACGT

TCGAGAACCGAACCATTGGACGATCGCAAACTGTCAACCCTTCTTGTCCTGCCNTCGGGTGGGGCACCCCCGTACGGCACGTCGCCCGGG …

Iris macrosiphon internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Iris macrosiphon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈4 329 924 449 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris macrosiphon4.33 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.407 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 994 records

Wild obs. + sensor2 526

Museum / vouchered468

Range

Area of Occupancy AOO3 692 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 638≤1 km 293≤10 km 100>10 km 45

2 076 georeferenced · 450 without coordinates

Open the mapobservation + sensor2 526

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 10≤1 km 153≤10 km 101>10 km 14

278 georeferenced · 190 without coordinates

Open the institutions mapphysical evidence468

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Angwin, US	73
Davis, US	66
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	65
Arcata, US	48
Chicago, US	20
Claremont, US	18
CASlocation not on record	15
Canadian Department of Agriculturelocation not on record	10
Santa Barbara, US	6
Riverside, US	6
Paris, FR	5
San Diego, US	5
Nantes Culture Collectionlocation not on record	4
Northridge, US	3
Turlock, US	3
Bloomington, US	2
Flagstaff, US	2
STNFlocation not on record	2
US	2
Irvine, US	2
Long Beach, US	2
Madison, US	2
WTUlocation not on record	1
Bronx, US	1
San Angelo, US	1
Chongqing Museumlocation not on record	1
GB	1
Ashland, US	1
Missoula, US	1
DOI/NPS, Greenbelt Parklocation not on record	1
AUAlocation not on record	1
Auckland, NZ	1
Oskarshamn, SE	1
Fredericton Stock Culture Collectionlocation not on record	1
Bangkok, TH	1
Tampa, US	1

36 institutions · 375 of 468 vouchered records shown · 93 without an institution code

09Environmental DNA2 detections

Where the DNA of Iris macrosiphon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris macrosiphon

At a glance

Sources12 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type2 994 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions26 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 994 records