Iris maackii — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records1

Data sources6

Biological traits11

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Iris maackii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF1 records

DNA & barcodingNCBIsequences

01Narrative

Iris maackii is a species in the genus Iris; it is also in the subgenus Limniris and in the series Laevigatae. It is a rhizomatous perennial, from China and eastern Russia. It has sword-shaped grey-green leaves, and has many branched flowering stems that carry flowers in May that come in various shades of yellow.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology3

Fruit length75 mm

Fruit length max90 mm

Fruit length min60 mm

Life cycle & reproduction2

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris maackii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSDQ472159.1 ↗667 bp

ACGT

TCGAGAACCGAACCATCGGACGATCGCGAATGTGTCAATACTCTCCGTCCTGCCCTCTGGCGGGGCACCCCCGTACGGCCCGTCGACCCC …

Iris maackii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type1 records

Museum / vouchered1

Range

Area of Occupancy AOO4 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

10Collections & institutions

Institution	Specimens
Moscow State Universitylocation not on record	1

1 institutions · 1 of 1 vouchered records shown