Iris lortetii

Barbey · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records2 648

Data sources6

Biological traits10

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Iris lortetii's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 648 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF2 648 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB7.6 Gbp

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris lortetii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLOR098705.1 ↗153 194 bpIsrael · 2019

ACGT

CCCGATATCTTACTAAAACAAGATATCGGGCATGGATCCTTCAACGATTCGTATACATTAATACGGAAATCTTATCCATTTATAGATGGA …

Iris lortetii voucher IrisSV1904 plastid, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris lortetii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size7 559 940 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris lortetii7.56 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×CCDB · ipcn-api-dl · CCDB · Cave1956 · CCDB · iris-lebanon

CCDB · ipcn-api-dl — Avishai, M. & D. ZOHARY. 1977. Chromosomes in the Oncocylus Irises. Bot. Gaz. 138: 5 502–5 1 1.

CCDB · Cave1956 — Mitra

CCDB · iris-lebanon — Samad, N. A.,Dagher-Kharrat, M. B., Hidalgo, O., El Zein, R., Douaihy, B., & Siljak-Yakovlev, S. (2016). Unlocking the Karyological and Cytogenetic Diversity of Iris from Lebanon: Oncocyclus Section Shows a Distinctive Profile and Relative Stasis during Its Continental Radiation. PLOS ONE, 11(8), e0160816.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.256 ↗

08Occurrence & distribution

Record type2 648 records

Wild obs. + sensor2 639

Museum / vouchered9

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 4>10 km 85

89 georeferenced · 2 550 without coordinates

Open the mapobservation + sensor2 639

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	9

1 institutions · 9 of 9 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris lortetii

At a glance

Sources6 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment6

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 648 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions1 of 1 geolocated

Record type2 648 records