Iris lacustris

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records1 147

Data sources12

Biological traits10

DNA specimens10

eDNA detections7

Sources12 archives

Databases and archives Iris lacustris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 147 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF1 147 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB4.1 Gbp

01Narrative

Iris lacustris, the dwarf lake iris, is a plant species in the genus Iris, subgenus Limniris and in the section Lophiris (crested irises). It is a rhizomatous, beardless perennial plant, native to the Great Lakes region of eastern North America. It has lavender blue or violet-blue flowers, a very short stem and long fan-like green leaves. It is cultivated as an ornamental plant in temperate regions. It is closely related to Iris cristata (another North American crested iris).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris lacustris has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences5

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMK526019.1 ↗549 bp

ACGT

AAAGCAAGTGTTGGATTTAAAGCTGGCGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTG …

Iris lacustris ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris lacustris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 107 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris lacustris4.11 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–422n range32median32mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 323×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Pringle, J. S. 1976. Annotated chromosome counts for some plants of the dunes and pannes along the shores of the upper Great Lakes. Michigan Bot. 15: 157–163.

CCDB · book-ipcn75-78 — Pringle 1976

2n 421×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.B. 1973. Cytogenetic studies in the genus Iris: Subsection Evansia, Benth. Cytologia 38: 501-514.

n 211×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.B. 1973. Cytogenetic studies in the genus Iris: Subsection Evansia, Benth. Cytologia 38: 501-514.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 147 records

Wild obs. + sensor1 092

Museum / vouchered55

Range

Area of Occupancy AOO2 680 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 165≤1 km 53≤10 km 24>10 km 804

1 046 georeferenced · 46 without coordinates

Open the mapobservation + sensor1 092

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 1≤1 km 4≤10 km 5>10 km 2

12 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	15
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	15
Chicago, US	6
Museum of the Rockieslocation not on record	4
University of Guelph, OAC Herbariumlocation not on record	3
Tampa, US	2
St. Paul, US	2
Jena Microbial Resource Collectionlocation not on record	1
Wuzhou, CN	1
Paris, FR	1
Acadia Universitylocation not on record	1
Denver, US	1
Saint Louis, US	1

13 institutions · 53 of 55 vouchered records shown · 2 without an institution code

09Environmental DNA7 detections

Where the DNA of Iris lacustris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

sand dunesunder cedar among limestone outcrops with Py…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 16.9–17.1

Seasonal swing summer↔winter26.7 °C

Max temp (day)20.2 °C 19.9–20.2

Min temp (night)14.6 °C 14.6–14.8

Precipitation81.4 mm/mo 77.0–81.4

Air humidity60.5 % 60.5–61.0

Moisture balance-67.9 mm/mo -68.1–-67.9

Vapour deficit767 Pa 752–767

Wind speed3.10 m/s 3.10–3.80

Cloud cover41.2 % 41.1–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris lacustris

At a glance

Sources12 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment6

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 147 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 147 records