Iris lactea

Pall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records697

Data sources12

Biological traits28

DNA specimens10

eDNA detections10

Sources12 archives

Databases and archives Iris lactea's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility697 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS20 compounds

Occurrence & distributionGBIF697 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 40

01Narrative

Iris lactea is a species in the genus Iris, it is also in the subgenus Limniris. and the series Ensatae, it is the only species in the series. The Japanese water iris, Iris ensata, is actually in series Laevigatae. It is a rhizomatous perennial, from central Asia, with pale blue or violet flowers. It is cultivated as an ornamental plant in temperate regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length50 mm

Fruit length max60 mm

Fruit length min40 mm

Leaf size1 125 mm²

Life cycle & reproduction5

DeciduousnessN

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticsemiaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Leaf formlinear

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry7

Leaf C:N ratio24.31 g/g

Leaf c494 mg/g

Leaf dry-matter content (LDMC)313 mg/g

Leaf n20.4 mg/g

Leaf p1.9 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)7.69 mm²/mg

Other traits3

Leaf marginentire

Leaf spinesno

Leaf thornsno

03Chemical composition20 compounds

Compounds documented for Iris lactea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones8

Cinnamic acids and derivatives4

Plant xanthones3

Stigmastane steroids1

Simple phenolic acids1

Documented compounds20 total

Tissue Source Quantified only

Compound	Amount	Source
1,3,6,7-tetrahydroxy-2-[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]xanthen-9-one	present	LOTUS
3-(4-Hydroxy-3-Methoxyphenyl)Prop-2-Enoic Acid	present	LOTUS
4-Coumaric acid	present	LOTUS
4-Hydroxybenzoic acid	present	LOTUS
5-Hydroxy-2'-methoxyflavone	present	LOTUS
5-Hydroxy-3'-methoxyflavone	present	LOTUS
6-[3,4-Dihydroxy-6-(hydroxymethyl)-5-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-2-yl]oxy-5-hydroxy-7-methoxy-2-(4-methoxyphenyl)chromen-4-one	present	LOTUS
[(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S,6R)-4,5-dihydroxy-2-[5-hydroxy-7-methoxy-2-(4-methoxyphenyl)-4-oxochromen-6-yl]-6-(hydroxymethyl)oxan-3-yl]oxy-4,5-dihydroxy-6-methyloxan-3-yl] acetate	present	LOTUS
[2-[4,5-Dihydroxy-2-[5-hydroxy-7-methoxy-2-(4-methoxyphenyl)-4-oxochromen-6-yl]-6-(hydroxymethyl)oxan-3-yl]oxy-4,5-dihydroxy-6-methyloxan-3-yl] acetate	present	LOTUS
gamma-Sitosterol	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris lactea has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes5

GenBank sequences10

eDNA detections10

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMT930334.1 ↗568 bpChina

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTTAAGGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTATGAAACCAAAGATACT …

Iris lactea voucher TLF-026 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7★rbcLa★ITS★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris lactea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Doronkin, V. M. & A. A. Krasnikov. 1984. Cytotaxonomic studies in some Siberian species of the genus Iris (Iridaceae). Bot. Zhurn. SSSR 65(5): 683–685. (In Russian).

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type697 records

Wild obs. + sensor464

Museum / vouchered226

Cultivated / captive1

Other6

Origin

Native1

Range

Area of Occupancy AOO2 000 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 192≤1 km 57≤10 km 48>10 km 31

328 georeferenced · 136 without coordinates

Open the mapobservation + sensor464

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 15≤10 km 15>10 km 5

36 georeferenced · 190 without coordinates

Open the institutions mapphysical evidence226

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	38
Beijing, CN	23
WNNUlocation not on record	22
Irkutsk State Universitylocation not on record	21
Urumqi, CN	16
Nanjing, CN	12
Changsha, CN	9
Herbarium of the Department of Botany, University of Tokyolocation not on record	8
Denver, US	7
KR	7
Edinburgh, GB	5
National Institute of Biological Resourceslocation not on record	5
GMBAlocation not on record	5
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	5
Kyoto Universitylocation not on record	3
Kunming, CN	3
SXTCMlocation not on record	2
Herbarium of South China Botanical Gardenlocation not on record	2
Chengdu, CN	2
Tsukuba, JP	1
BRNUlocation not on record	1
ENTClocation not on record	1
Hazara Universitylocation not on record	1
Guilin, CN	1
Capital Normal Universitylocation not on record	1
Lanzhou, CN	1
Claremont, US	1
Paris, FR	1
Zhejiang Museum of Natural Historylocation not on record	1
Seoul, KR	1
Tianjin Natural History Museumlocation not on record	1
JP	1
Wuhan, CN	1
Shanghai, CN	1
Madison, US	1
South Kensington, GB	1
Peking Universitylocation not on record	1
Museum of the Rockieslocation not on record	1
Kew, GB	1

39 institutions · 215 of 226 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Iris lactea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.5 °C 27.5–31.5

Seasonal swing summer↔winter41.8 °C

Max temp (day)34.8 °C 32.4–37.2

Min temp (night)22.5 °C 20.4–24.6

Precipitation7.50 mm/mo 4.20–10.8

Air humidity38.6 % 37.2–40.1

Moisture balance-174 mm/mo -187–-162

Vapour deficit2,565 Pa 2,207–2,923

Wind speed3.30 m/s 2.50–4.10

Cloud cover34.0 % 27.2–40.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)