Iris korolkowii

Regel · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records84

Data sources8

Biological traits18

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Iris korolkowii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility84 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF84 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Iris korolkowii is a plant species in the genus Iris, it is also in the subgenus Iris and in the section Regelia. It is a rhizomatous perennial, from the mountains of Tien Shan, Pamir and Altai, in Afghanistan and Turkestan (now part of Uzbekistan). It is commonly known as the Redvein Iris. It has long, sword-shaped grey-green leaves, slender stem, and 2 to 3 white, cream, pale green or light purple flowers which are veined with maroon, chocolate brown or dark purple. It is cultivated as an ornamental plant in temperate regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.6 m

Plant height min0.4 m

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatetemperate

Climberself-supporting

Elevation max2 100 m

Elevation min1 600 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains

Mycorrhiza typearbuscular

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris korolkowii has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMZ054611.1 ↗906 bpUzbekistan · 2011

ACGT

ACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCTG …

Iris korolkowii voucher TASH-20110105 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris korolkowii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Gustafsson, M. & P. Wendelbo. 1975. Karyotype analysis and taxonomic comments on irises from SW and C Asia. Bot. Not. 128: 208–226.

CCDB · book-ipcn67-71 — ZAKHARYEVA O.I., & L.M. MAKUSHENKO. 1969. Chromosome numbers of monocotyledons belonging to the families Liliaceae, Iridaceae, Amaryllidaceae, Araceae. Bot. Zurn. 54: 1213-1227.

CCDB · book-ipcn75-78 — Bochantseva 1972

CCDB · book-ipcn75-78 — Gustafsson & Wendelbo 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.293 ↗

08Occurrence & distribution

Record type84 records

Wild obs. + sensor72

Museum / vouchered11

Cultivated / captive1

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 2

9 georeferenced · 63 without coordinates

Open the mapobservation + sensor72

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence11

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	2
Kunming, CN	2
BRNUlocation not on record	2
Kew, GB	1
Madison, US	1
Uniwersytet Opolskilocation not on record	1
Edinburgh, GB	1

7 institutions · 10 of 11 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)