Iris humilis

Georgi · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records1 557

Data sources9

Biological traits21

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Iris humilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 557 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF1 557 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 28

01Narrative

И́рис ни́зкий — многолетнее травянистое растение; вид рода Ирис (Iris) семейства Ирисовые (Iridaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology5

Fruit length40 mm

Fruit length max45 mm

Fruit length min35 mm

Plant height max0.35 m

Plant height min0.06 m

Life cycle & reproduction6

Flowering endJun

Flowering startMay

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticsemiaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows, sand, steppe, stony places

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)12.63 mm²/mg

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris humilis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLFM863876.1 ↗668 bpRussia · 2006

ACGT

TTGGTTCTCATAATAAAATGATTGAAATATGTCGAAATTTTTTTGGATTGGAGATTGGAATAGTACATAGTACCGAATCAAAAATAAATG …

Iris humilis chloroplast atpB gene (partial), IGS and rbcL gene (partial), isolate ALT-13

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL8

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris humilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records22–722n range28median28mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 286×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 11

CCDB · ipcn-api-dl — Krasnikova, S. A., A. A. Krasnikov, T. S. Rostovtzeva & V. M. Chanminchun. 1983. Chromosome numbers of some plant species from the south of Siberia. Bot. Zhurn. SSSR 68 (6): 827–835. (In Russian).

CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1980. Karyological studies of some species of the Mongolian flora. Folia Geobot. Phytotax. 15: 395–405.

CCDB · ipcn-api-dl — Starodubtsev, V. N. & L. N. Mironova. 1990. Chromosome numbers in the species of the genus Iris (Iridaceae) from the flora of the Primorye Territory. Bot. Žhurn. (Moscow & Leningrad) 75: 123.

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · ipcn-api-dl — Malakhova, L. A. & G. A. Markova. 1994. Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones. Bot. Žhurn. (Moscow & Leningrad) 79(7): 134–135.

2n 224×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants +1

CCDB · fl-europaea — Mitra, 1956

CCDB · ipcn-api-dl — Doronkin, V. M. & A. A. Krasnikov. 1984. Cytotaxonomic studies in some Siberian species of the genus Iris (Iridaceae). Bot. Zhurn. SSSR 65(5): 683–685. (In Russian).

CCDB · book-atlas-flowering-plants — Simonet 1934a

CCDB · Cave1956 — Mitra

2n 273×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.

CCDB · book-ipcn75-78 — Krogulevich 1978

2n 721×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Simonet 1934a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.200 ↗

08Occurrence & distribution

Record type1 557 records

Wild obs. + sensor1 330

Museum / vouchered222

Cultivated / captive5

Origin

Introduced1

Range

Area of Occupancy AOO4 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 391≤1 km 117≤10 km 74>10 km 360

942 georeferenced · 388 without coordinates

Open the mapobservation + sensor1 330

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 1≤1 km 27≤10 km 74>10 km 5

107 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence222

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Irkutsk State Universitylocation not on record	64
Moscow State Universitylocation not on record	51
BRNUlocation not on record	18
Vitebsk State University named after P.M. Masherovlocation not on record	7
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	4
Salzburg, AT	2
South Kensington, GB	2
Paris, FR	1
Chongqing Museumlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
IWEP FEB RASlocation not on record	1
MSB-3797location not on record	1

12 institutions · 153 of 222 vouchered records shown · 68 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Iris humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median4.00 °C 4.00–4.00

Seasonal swing summer↔winter26.5 °C

Max temp (day)8.20 °C

Min temp (night)-1.90 °C

Precipitation45.6 mm/mo

Air humidity54.0 %

Moisture balance-22.6 mm/mo

Vapour deficit456 Pa

Wind speed1.50 m/s

Cloud cover30.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris humilis

At a glance

Sources9 archives

Size & morphology5

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 557 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 12 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 557 records