Iris hookeri

Penny ex G.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records968

Data sources10

Biological traits10

DNA specimens17

eDNA detections14

Sources10 archives

Databases and archives Iris hookeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility968 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF968 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceCCDB2n = 38

01Narrative

L'iris à pétales aigus est une plante herbacée vivace à rhizome court de la famille des Iridaceae. On le retrouve dans les provinces maritimes de l'est du Canada ainsi que dans l'estuaire du Saint-Laurent, dont il remonte la rive nord pour atteindre le Labrador. L'iris à pétales aigus est considéré par certains botanistes comme une variété de l'Iris setosa, une espèce retrouvée aussi dans l'est de l'Asie et dans l'ouest de l'Amérique du Nord et dont l'Iris setosa var. canadensis serait la variété nord-américaine poussant aux abords de l'Atlantique. L'iris à pétales aigus se distingue de l'Iris versicolore, auquel il ressemble, par des sépales plus larges et moins fortement teintés de jaunes, des pétales plus petits, mais surtout par son habitat. L'Iris hookeri se rencontre dans les lieux secs, telles les anfractuosités des rochers, aux abords des rivages maritimes, alors que l'iris versicolore affectionne les lieux humides. Le fruit de l'iris à pétales aigus est une capsule verte, ovoïde et à trois loges, qui se forme généralement au cours de l'été.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris hookeri has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes5

GenBank sequences10

eDNA detections14

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG215970.1 ↗375 bpCanada · 1985

ACGT

TGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Iris hookeri voucher 73370HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL1★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris hookeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 381×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type968 records

Wild obs. + sensor837

Museum / vouchered118

Cultivated / captive13

Origin

Native1

Range

Area of Occupancy AOO1 820 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 449≤1 km 101≤10 km 38>10 km 30

618 georeferenced · 219 without coordinates

Open the mapobservation + sensor837

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤1 km 11≤10 km 34>10 km 13

58 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence118

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	18
Montréal, CA	17
Saint John, CA	14
University of New Hampshirelocation not on record	12
Chongqing Museumlocation not on record	10
Madison, US	9
Bloomington, US	7
Acadia Universitylocation not on record	5
Paris, FR	4
Burlington, US	3
University of Stellenboschlocation not on record	3
University of Guelph, OAC Herbariumlocation not on record	2
Durham, US	2
Whitehorse, CA	1
James F. Matthews Center for Biodiversity Studieslocation not on record	1
Denver, US	1
Chicago, US	1
Students On Ice Foundationlocation not on record	1
Université Lavallocation not on record	1
Montréal, CA	1

20 institutions · 113 of 118 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Iris hookeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 12.9–15.4

Seasonal swing summer↔winter22.5 °C

Max temp (day)16.7 °C 16.0–19.6

Min temp (night)11.7 °C 10.4–12.1

Precipitation99.0 mm/mo 98.8–102

Air humidity62.2 % 58.7–63.0

Moisture balance-27.2 mm/mo -33.9–-23.4

Vapour deficit616 Pa 592–668

Wind speed4.60 m/s 3.80–5.10

Cloud cover58.1 % 54.5–58.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)