Iris histrio

Rchb.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records576

Data sources11

Biological traits10

DNA specimens0

eDNA detections1

Sources11 archives

Databases and archives Iris histrio's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility576 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF576 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT19.9 Gbp

01Narrative

Iris histrio, the Syrian iris, is a species in the genus Iris, it is classified in the subgenus Hermodactyloides and section Reticulatae. It is a bulbous perennial from Central Asia: Kyrgyzstan, Israel, Lebanon, Syria and southern Turkey. It was first collected by Charles Gaillardot in Lebanon in 1854.W.R.Dykes. The Genus Iris. 1913Kew Herbarium In 1873, Heinrich Gustav Reichenbach (Rchb.f) wrote about the bulb in his 'Botanische Notizen'. This then joined the subspecies of iris reticulata, which has now been grouped with other under the subgenus of Hermodactyloides.British Iris Society It is commonly known as the Syrian iris.Donald Wyman Iris histrio is an accepted name by the RHS. It has baby blue flowers with intricate markings, shading to purplish blue at the base. Like other members of the Reticulatae group, such as Iris vartanii and Iris danfordiae, it throws out a very large number of small bulbils round the base of the bulb. If these are planted separately in a reserve ground, they will develop into flowering bulbs in the course of two or three years. Seedlings of I. vartani certainly, and of I. histrio normally needs protection at all times, especially in the UK. It can grow in loamy soils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formbulbous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris histrio has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKHM574659.1 ↗1 569 bp

ACGT

ATGGAAGAATTACAAGGATATTTAGAAAAGGATAGATCTAGGCAACAACCCTTCCTATATCCGCTTCTCTTTCAGGAGTATATTTATGTA …

Iris histrio subsp. aintabensis maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK7

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Iris histrio carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size19 892 520 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Iris histrio19.89 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 205×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Johnson, M. A. T. & P. E. Brandham. 1997. New chromosome numbers in petaloid monocotyledons and in other miscellaneous angiosperms. Kew Bull. 52(1): 121–138.

CCDB · book-atlas-flowering-plants

CCDB · kew — Goldblatt P, Walbot V, Zimmer EA. 1984. Estimation of genome size (C-value) in Iridaceae by cytophotometry. Annals of the Missouri Botanical Garden 71: 176-180.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.396 ↗

08Occurrence & distribution

Record type576 records

Wild obs. + sensor553

Museum / vouchered22

Cultivated / captive1

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy7% within 1 km

≤100 m 6≤1 km 5≤10 km 11>10 km 142

164 georeferenced · 389 without coordinates

Open the mapobservation + sensor553

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence22

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	14
Kew, GB	7
Rishon Le Zion, IL	1

3 institutions · 22 of 22 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Iris histrio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)