Iris halophila

Pall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records1 735

Data sources10

Biological traits22

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Iris halophila's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 735 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS22 compounds

Occurrence & distributionGBIF1 735 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 44

01Narrative

И́рис солелюби́вый, или И́рис солончако́вый, или Каса́тик солелюби́вый, или Каса́тик солончако́вый — многолетнее травянистое растение; вид рода Ирис (Iris) семейства Ирисовые (Iridaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Fruit length75 mm

Fruit length max90 mm

Fruit length min60 mm

Plant height max1.1 m

Plant height min0.7 m

Life cycle & reproduction6

Flowering endJul

Flowering startJun

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticsemiaquatic

Climatetemperate

Climberself-supporting

Elevation max3 000 m

Elevation min1 500 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows: wet, saline places

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition22 compounds

Compounds documented for Iris halophila across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Germacrane sesquiterpenoids12

Monomeric stilbenes3

Oligomeric stibenes3

Kaurane and Phyllocladane diterpenoids2

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Kaur-16-en-19-oic acid	present	NPASS
(1R,2S,3S,5R,8E,11S)-2-hydroxy-5,9-dimethyl-14-methylidene-4,12-dioxatricyclo[9.3.0.03,5]tetradec-8-en-13-one	present	NPASS
5-(2-(4-Hydroxyphenyl)Ethenyl)Benzene-1,3-Diol	present	LOTUS
5-[2-(3-Hydroxy-2-methoxyphenyl)ethenyl]-2,3-dimethoxyphenol	present	LOTUS
5-[4-[2-[3-[3-(3,5-Dihydroxyphenyl)-6-hydroxy-2-(4-hydroxyphenyl)-2,3-dihydro-1-benzofuran-4-yl]-2-(4-hydroxyphenyl)-2,3-dihydro-1-benzofuran-5-yl]ethenyl]-6-hydroxy-2-(4-hydroxyphenyl)-2,3-dihydro-1-benzofuran-3-yl]benzene-1,3-diol	present	LOTUS
[(1R,2Z,4S,8R,9R,11R,12S)-1,12-dihydroxy-2-(hydroxymethyl)-11-methyl-7-methylidene-6-oxo-5,14-dioxatricyclo[9.2.1.04,8]tetradec-2-en-9-yl] (Z)-2-methylbut-2-enoate	present	NPASS
[(1S,2R,4S,6R,8R,9R,11R)-8-hydroxy-4,9-dimethyl-14-methylidene-13-oxo-5,12-dioxatricyclo[9.3.0.04,6]tetradecan-2-yl] (Z)-2-methylbut-2-enoate	present	NPASS
[(3aR,4R,6Z,10E,11aR)-4-hydroxy-10-methyl-3-methylidene-2-oxo-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-6-yl]methyl 2-methylpropanoate	present	NPASS
[(3aS,4R,5E,7S,9E,11aS)-4-hydroxy-6,10-dimethyl-3-methylidene-2-oxo-3a,4,7,8,11,11a-hexahydrocyclodeca[b]furan-7-yl] acetate	present	NPASS
[(3aS,4R,6R,7Z,10S,11aR)-6-hydroxy-6,10-dimethyl-3-methylidene-2,9-dioxo-3a,4,5,10,11,11a-hexahydrocyclodeca[b]furan-4-yl] 2-methylpropanoate	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris halophila has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences10

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ452344.1 ↗383 bpKazakhstan

ACGT

CTCCTTGGCCTGGGGGACGCCATCGCCGAGCGGCGCTGGTCGACGCTCGTTGGTGCCGCCCTCCAAGCCGCACAAACGAACCCCGGCGCA …

Iris halophila voucher KS23 HER0274 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iris halophila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records20–442n range44median44mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 444×CCDB · book-ipcn67-71 · CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn67-71 — ZAKHARYEVA O.I., & L.M. MAKUSHENKO. 1969. Chromosome numbers of monocotyledons belonging to the families Liliaceae, Iridaceae, Amaryllidaceae, Araceae. Bot. Zurn. 54: 1213-1227.

CCDB · eflora

CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — La Cour unp.

2n 201×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — LUNGEANU, I. 1973. In IOPB chromosome number reports XLII. Taxon 22: 647-654.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.940 ↗

08Occurrence & distribution

Record type1 735 records

Wild obs. + sensor1 213

Museum / vouchered514

Cultivated / captive3

Other5

Origin

Native3

Introduced7

Range

Area of Occupancy AOO3 932 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 577≤1 km 150≤10 km 97>10 km 76

900 georeferenced · 313 without coordinates

Open the mapobservation + sensor1 213

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 38≤1 km 166≤10 km 105>10 km 31

340 georeferenced · 174 without coordinates

Open the institutions mapphysical evidence514

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	85
Beijing, CN	29
Vitebsk State University named after P.M. Masherovlocation not on record	29
Urumqi, CN	20
Yangling, CN	12
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	11
Voronezh State Universitylocation not on record	10
Guangzhou, CN	10
BRNUlocation not on record	5
Berlin, DE	3
Xian, CN	2
Guilin, CN	2
Universität Göttingenlocation not on record	2
Chengdu, CN	2
Nanjing, CN	2
Xining, CN	2
Barcelona, ES	1
Herbarium of South China Botanical Gardenlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Edinburgh, GB	1

20 institutions · 230 of 514 vouchered records shown · 284 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Iris halophila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 24.0–24.0

Seasonal swing summer↔winter39.5 °C

Max temp (day)29.1 °C

Min temp (night)16.7 °C

Precipitation12.8 mm/mo

Air humidity41.5 %

Moisture balance-183 mm/mo

Vapour deficit1,739 Pa

Wind speed4.50 m/s

Cloud cover44.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris halophila

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction6

Diet & foraging1

Habitat & environment9

Other traits1

Compound class profile4 classes

Documented compounds22 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 735 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 735 records