Iris graminea

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records5 971

Data sources11

Biological traits27

DNA specimens2

eDNA detections1

Sources11 archives

Databases and archives Iris graminea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 971 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF5 971 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT5.2 Gbp

01Narrative

Iris graminea L. est une espèce de plantes à fleurs de la famille des Iridaceae et appartenant au sous-genre Limniris du genre Iris, faisant partie de la série Spuriae. C'est une plante vivace à rhizome, à fleurs violettes ou bleu violet et à feuilles étroites. La plante porte plusieurs noms communs dont l'iris à feuilles de graminée, l'iris de Bayonne, l'iris prune et l'iris tarte aux prunes. On le cultive comme plante ornementale dans les régions tempérées. Cette espèce est naturellement présente dans la moitié sud-est de l'Europe, entre l'Espagne et l'Ukraine, traversant une grande partie du Caucase.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology8

Plant height0.225 m

Plant height generative0.225 m

Plant height max0.6 m

Plant height min0.15 m

Seed length5.31 mm

Seed mass17.81 mg

⚠ sources differ — TRY: 17.81 mg · LEDA: 22.82 mg · GIFT: 20.39 mg

Seed mass max22.82 mg

Seed mass min12.79 mg

Life cycle & reproduction6

Deciduousnessevergreen

Flowering endJun

Flowering startJun

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmeadows

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)226 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)16.72 mm²/mg

Other traits2

Diaspore typeseed

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris graminea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKHM574670.1 ↗1 569 bp

ACGT

ATGGAAGAATTACAGGGATATTTAGAAAAGGATAGATCCAGGCAACAACCCTTCCTATATACGCTTCTCTTTCAGGAGTATATTTATGCA …

Iris graminea maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Iris graminea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size5 173 620 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris graminea5.17 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records24–342n range34median34mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3415×CCDB · ita-fl · CCDB · slov-fl · CCDB · fl-europaea +6

CCDB · ita-fl — RICCI I., ZACCHEO COLASANTE M. - 1974. Iris graminea L.: analisi cariologica.. Giorn. Bot. Ital. , 108(1-2): 75-80.

CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.

CCDB · fl-europaea — Susnik et al.,

CCDB · ipcn-api-dl — Colasante, M. & W. Sauer. 1993. The genus Iris L. in Latium (central Italy): general remarks on the morphological and karyological differentiation as well as on the ecological adaptation and flowering periods. Linzer Biol. Beitr. 25: 1189–1204.

CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.

CCDB · ipcn-api-dl — POPOVA, M. & I. CESCHMEDJIEV. 1975. In IOPB chromosome number reports XLVII. Taxon 24: 143–146.

CCDB · ipcn-api-dl — POPOVA, M. & I. CESCHMEDJIEV. 1976. Karyologic investigation of the genus Iris L. in Bulgaria. Phytologija (Sofia) 5: 57–65.

CCDB · ipcn-api-dl — Uhrikova, A. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.

CCDB · book-ipcn72 — SUSNIK, F., B. DRUSKOVIC, A. LOEVE & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 31-346.

CCDB · book-ipcn75-78 — Popova & Ceshmedjiev 1976

CCDB · book-ipcn75-78 — Uhrikova 1976

CCDB · book-ipcn75-78 — Popova & Ceschmedjiev 1975

CCDB · book-ipcn73-74 — RICCI, I., & M.Z. COLASANTE. 1974. Iris graminea L.: analisi cariologia. Giorn. Bot. Ital. 108: 75-80.

CCDB · book-atlas-flowering-plants — Simonet 1934a

CCDB · Cave1963 — Lenz & Day 1963

2n 242×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.205 ↗

08Occurrence & distribution

Record type5 971 records

Wild obs. + sensor5 672

Museum / vouchered278

Cultivated / captive3

Other18

Range

Area of Occupancy AOO9 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 1 551≤1 km 318≤10 km 1 928>10 km 109

3 906 georeferenced · 1 766 without coordinates

Open the mapobservation + sensor5 672

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 18≤1 km 33≤10 km 41>10 km 1

93 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence278

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	68
LDlocation not on record	20
Moscow State Universitylocation not on record	18
Vitoria, ES	15
San Sebastián, ES	14
BRNUlocation not on record	12
GJOlocation not on record	8
Oskarshamn, SE	8
Wlocation not on record	6
Bern, CH	6
SLU Artdatabankenlocation not on record	6
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
Barcelona, ES	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Provincia di Livornolocation not on record	3
Porrentruy, CH	3
BFLlocation not on record	3
Mlocation not on record	3
Pamplona, ES	3
Pamplona, ES	3
OLAlocation not on record	2
DBF-NHMDlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
GZUlocation not on record	2
Uniwersytet Wrocławskilocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
BG-NMNHSlocation not on record	2
València, ES	1
Universität Göttingenlocation not on record	1
PRClocation not on record	1
SNSNMClocation not on record	1
BClocation not on record	1
Frankfurt am Main	1
Salzburg, AT	1
IPE-CSIClocation not on record	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Görlitz, DE	1
Oulu, FI	1
Xiamen, CN	1

40 institutions · 241 of 278 vouchered records shown · 37 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Iris graminea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Iris graminea

At a glance

Sources11 archives

Size & morphology8

Life cycle & reproduction6

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type5 971 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions15 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type5 971 records