Iris glaucescens

Bunge · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records571

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Iris glaucescens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility571 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF571 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 24

01Narrative

Iris glaucescens is a plant species in the genus Iris, it is also in the subgenus Iris. It is a rhizomatous perennial, found in Russia, Kazakhstan, Mongolia and China. It has blue-grey sickle-shaped leaves, slender stem, and spring flowers in blue-violet, pale violet, lilac-purple, to deep purple, to light bluish, and almost white shades. It is rarely cultivated as an ornamental plant in temperate regions. It was merged with another similar iris in the region, and became a synonym of Iris scariosa, before being divided into two separate species again. Although some sources still call it a synonym of Iris scariosa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticsemiaquatic

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris glaucescens has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

rbcLPX505513.1 ↗153 453 bp

ACGT

CCCGATATCTTGTTTTAGTAAGATATCGGGCATGGATCCTTCAACGATTCGTATACATTAATACGGAAATCTTATCCATTTATAGATGGA …

Iris glaucescens isolate ipbb_40.3.3.1 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris glaucescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 26

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.043 ↗

08Occurrence & distribution

Record type571 records

Wild obs. + sensor462

Museum / vouchered107

Cultivated / captive2

Range

Area of Occupancy AOO1 268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 168≤1 km 55≤10 km 30>10 km 46

299 georeferenced · 163 without coordinates

Open the mapobservation + sensor462

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤1 km 99≤10 km 1

100 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence107

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	4
Paris, FR	3

2 institutions · 7 of 107 vouchered records shown · 100 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)