Iris fulva

Ker Gawl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records664

Data sources11

Biological traits89

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Iris fulva's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility664 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources89 traits

Chemical compositionLOTUS · NPASS19 compounds

Occurrence & distributionGBIF664 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB9.6 Gbp

01Narrative

Iris fulva est une espèce de plantes de la famille des Iridacées originaire d'Amérique du Nord.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height1 m

Life cycle & reproduction24

Bloom periodMid Spring

Coppice potentialNo

Flower colourred

Flower conspicuousYes

Fruit seed period beginSpring

Fruit seed period endSummer

Growth rate USDAModerate

Life formrhizomatous geophyte

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootNo

Propagated by bulbYes

Propagated by containerNo

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersYes

Raunkiær life formcryptophyte

Resprout abilityNo

Seed spread rateSlow

Seedling vigorHigh

Vegetative spread rateModerate

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring

Adapted to coarse textured soilsNo

Adapted to fine textured soilsYes

Adapted to medium textured soilsYes

Aquaticterrestrial

BloatNone

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerModerate

Foliage porosity winterPorous

Foliage textureMedium

Fruit colourgreen

Growth formherb

Growth form USDARhizomatous

Hedge toleranceNone

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min16 in

Shape and orientationErect

Small grainNo

Woodinessnon-woody

Physiology & chemistry19

Anaerobic toleranceHigh

C:N ratioMedium

Caco3 toleranceHigh

Cold stratification requiredNo

Drought toleranceLow

Fertility requirementMedium

Fire resistantNo

Fire toleranceMedium

Frost free days min180 days

Moisture useHigh

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max65 in

Precipitation min40 in

Salinity toleranceNone

Shade toleranceLow

Soil pH max8.5 pH

Soil pH min5 pH

Temperature min-24 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalMedium

Palatable graze animalMedium

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicityNone

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceHigh

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max19 360 per acre

Planting density min2 728 per acre

03Chemical composition19 compounds

Compounds documented for Iris fulva across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Acyclic monoterpenoids2

Cinnamic acids and derivatives1

Flavonols1

Flavones1

Flavanones1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3S)-2-(4-hydroxyphenyl)-5-methoxy-8,8-dimethyl-3,4,9,10-tetrahydro-2H-pyrano[2,3-h]chromen-3-ol	present	NPASS
(3R)-5-[[(2R,3S,4S,5R,6S)-6-[(3S)-3,7-dimethylocta-1,6-dien-3-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-3-hydroxy-5-oxopentanoic acid	present	LOTUS
(3S,4S)-4-ethyl-3-hydroxy-4-methyldihydro-2(3H)-furanone	present	NPASS
2,4-dihydroxy-3-[(2R)-2-hydroxy-3-methylbut-3-enyl]-6-methoxybenzaldehyde	present	NPASS
3,5,4'-Trihydroxy-6'',6''-dimethylpyrano[2,3:7,6]flavone	present	NPASS
3-[[(2S)-3,3-dimethyloxiran-2-yl]methyl]-2,4-dihydroxy-6-methoxybenzaldehyde	present	NPASS
4,5-Di-O-methyl-8-prenylafzelechin-4beta-ol	present	NPASS
[(1R,2R,3R,4R,5S,6S)-4-acetyloxy-2,3-dihydroxy-5,6-bis[[(Z)-2-methylbut-2-enoyl]oxy]cyclohexyl] (Z)-2-methylbut-2-enoate	present	NPASS
[(1R,2S,3R,4R,5R,6R)-3,4-bis(2,3-dimethylbut-2-enoyloxy)-2,5,6-trihydroxycyclohexyl] 2,3-dimethylbut-2-enoate	present	NPASS
[(1R,2S,3R,4R,5R,6R)-3-(2,3-dimethylbut-2-enoyloxy)-2,5,6-trihydroxy-4-[(Z)-2-methylbut-2-enoyl]oxycyclohexyl] 2,3-dimethylbut-2-enoate	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris fulva has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMW010963.1 ↗553 bpNew Zealand · 1957

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCTGATTACGAAACCAAAGATACTGATATCTTGGCAGC …

Iris fulva voucher DAOM:62211 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris fulva carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size9 569 730 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Iris fulva9.57 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–422n range42median42mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 423×CCDB · book-ipcn66 · CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · book-ipcn66 — Randolph 1966

CCDB · eflora

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.724 ↗

08Occurrence & distribution

Record type664 records

Wild obs. + sensor570

Museum / vouchered94

Origin

Native1

Range

Area of Occupancy AOO1 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 311≤1 km 73≤10 km 17>10 km 62

463 georeferenced · 107 without coordinates

Open the mapobservation + sensor570

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 2≤1 km 9≤10 km 23>10 km 1

35 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	17
US	12
Saint Louis, US	10
Jena Microbial Resource Collectionlocation not on record	8
University of Stellenboschlocation not on record	5
Jackson, US	5
Bronx, US	4
Fayetteville, US	4
Edmonton, CA	4
Mississippi State, US	3
University of Southern Mississippilocation not on record	3
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	3
Madison, US	3
James F. Matthews Center for Biodiversity Studieslocation not on record	2
Museum of the Rockieslocation not on record	1
Little Rock, US	1
Oregon State Universitylocation not on record	1
Chongqing Museumlocation not on record	1
Missoula, US	1
University of South Carolina Salkehatchielocation not on record	1
DOI/NPS, Selma to Montgomery National Historic Traillocation not on record	1
Henderson State Universitylocation not on record	1

22 institutions · 91 of 94 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Iris fulva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)