Iris formosana

Ohwi · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records72

Data sources8

Biological traits16

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Iris formosana's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility72 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF72 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Iris formosana is a plant species in the genus Iris, it is also in the subgenus Limniris and the section Lophiris. It is a rhizomatous perennial plant, from Taiwan, it has large white or lilac flowers. It is commonly known as the 'Taiwan iris'. It is cultivated as an ornamental plant in temperate regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Fruit length35 mm

Fruit length max40 mm

Fruit length min30 mm

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation mean750 m

Elevation min500 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris formosana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKC510980.1 ↗2 579 bp

ACGT

ACACATTTTTGGATGAAGCAACGAATTCGTCCAGACTATTGGTAGAGTCTATAAGACCGCGACTGATCCTGAAAGGTAATGAATGGGAAA …

Iris formosana voucher Chung 1928 HAST tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris formosana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-atlas-flowering-plants — Yasui 1939

2n 351×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — CHIMPHAMBA, B.B. 1973. Cytogenetic studies in the genus Iris: Subsection Evansia, Benth. Cytologia 38: 501-514.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.049 ↗

08Occurrence & distribution

Record type72 records

Wild obs. + sensor45

Museum / vouchered27

Origin

Native5

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 21≤1 km 8≤10 km 2>10 km 2

33 georeferenced · 12 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	9
Taipei, TW	7
TAIElocation not on record	5
Taipei, TW	2
Paris, FR	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Jishou Universitylocation not on record	1
Nishihara, JP	1

8 institutions · 27 of 27 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)