Iris clarkei

Baker ex Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Iris

At a glance

Occurrence records28

Data sources12

Biological traits16

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Iris clarkei's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Iris clarkei is a species in the genus Iris, also the subgenus of Limniris and in the series Sibiricae. It is a rhizomatous herbaceous perennial, from Asia, including north east India, Nepal, Tibet, Bhutan, Burma and in China. It has grey-green leaves, long and thin green stem and violet, to dark blue, to blue or reddish purple flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Fruit length42.5 mm

Fruit length max50 mm

Fruit length min35 mm

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max4 300 m

Elevation min2 300 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition14 compounds

Compounds documented for Iris clarkei across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Aplysiatoxins6

Oligomeric stibenes4

Lipopeptides3

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3R,4S,5S,9R,13S,14R)-3-[(2S,5R)-5-(4-chloro-3-hydroxyphenyl)-5-methoxypentan-2-yl]-13-hydroxy-9-[(1S)-1-hydroxyethyl]-4,14,16,16-tetramethyl-2,6,10,17-tetraoxatricyclo[11.3.1.11,5]octadecane-7,11-dione	present	NPASS
(2S,3S,10R,11R,18S,19S)-3,11,19-tris(4-hydroxyphenyl)-4,12,20-trioxaheptacyclo[16.6.1.12,5.110,13.021,25.09,27.017,26]heptacosa-1(25),5,7,9(27),13,15,17(26),21,23-nonaene-7,15,23-triol	present	LOTUS
[3-[(1R,4S)-4-[(1S,3R,4S,5S,9R,13S,14R)-13-hydroxy-9-[(1S)-1-hydroxyethyl]-4,14,16,16-tetramethyl-7,11-dioxo-2,6,10,17-tetraoxatricyclo[11.3.1.11,5]octadecan-3-yl]-1-methoxypentyl]phenyl] acetate	present	NPASS
Alpha-Viniferin	present	LOTUS
Anhydrodebromaplysiatoxin	present	NPASS
Aplysiatoxin	present	NPASS
Benzo(6,7)cyclohepta(1,2,3-cd)benzofuran-4,8,10-triol, 1,6,7,11b-tetrahydro-1,7-bis(4-hydroxyphenyl)-, (1S,7S,11bS)-	present	LOTUS
Debromoaplysiatoxin	present	NPASS
malyngamide I acetate	present	NPASS
Malyngamide M	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iris clarkei has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKFJ197272.1 ↗1 575 bp

ACGT

ATGGAAGAATTACAAGGATATTTAGAAAAGGATAGATCTAGGCAACAACCCTTCCTATATCCGCTTCTCTTTCAGGAGTATATTTATGCG …

Iris clarkei tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Iris clarkei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidypolyploid inferred

Chromosome records38–402n range39median38mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · book-ipcn66 · CCDB · book-indian_vol2

CCDB · book-ipcn66 — Kurosawa 1966

CCDB · book-indian_vol2 — Kurosawa, S. 1966, 1971 b

2n 402×CCDB · book-indian_vol2 · CCDB · eflora

CCDB · book-indian_vol2 — Simonet, M. 1934a

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.399 ↗

08Occurrence & distribution

Record type28 records

Wild obs. + sensor15

Museum / vouchered9

Cultivated / captive4

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 2≤1 km 2≤10 km 2>10 km 1

7 georeferenced · 8 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	4
Cambridge, US	1
Kunming, CN	1
Hazara Universitylocation not on record	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1

5 institutions · 8 of 9 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Iris clarkei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)