Intsia palembanica

Miq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Intsia

At a glance

Occurrence records271

Data sources11

Biological traits19

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Intsia palembanica's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility271 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF271 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Intsia palembanica is a species of flowering plants in the family Fabaceae. The plant common names include Borneo teak, Malacca teak, merbau and Moluccan ironwood where it is native to tropical rainforests in Southeast Asia and the islands of the southwest Pacific. Intsia palembanica differ from Intsia bijuga in the number of leaflets that make up their compound leaves.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Plant height40 m

Seed mass7 000 mg

Seed mass max7 000 mg

Seed mass min7 000 mg

Seed volume8 800 mm³

Seed volume max8 800 mm³

Seed volume min8 800 mm³

Life cycle & reproduction3

Deciduousnessevergreen

⚠ sources differ — TRY: evergreen · GIFT: deciduous

Life formtree

Life spanperennial

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density659 mg/cm³

03Chemical composition2 compounds

Compounds documented for Intsia palembanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Myricetin		present	LOTUS
Robinetin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Intsia palembanica has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSMH487705.1 ↗763 bp

ACGT

GAACCTGCGGAAGGATCATTGTCGATACCTCACGAGCAGCACGACCCGCGAACACGTTATCTATCTCCATCGTCCGATGGATCCCACACG …

Intsia palembanica strain Ip415 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type271 records

Wild obs. + sensor64

Museum / vouchered161

Other46

Range

Area of Occupancy AOO476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤1 km 19≤10 km 1>10 km 6

26 georeferenced · 38 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence161

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Xiamen, CN	4
Bronx, US	1
Kew, GB	1
Monastir, TN	1
Saint Louis, US	1
Fort Worth, US	1

6 institutions · 9 of 161 vouchered records shown · 152 without an institution code

09Environmental DNA2 detections

Where the DNA of Intsia palembanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)