Intsia bijuga

(Colebr.) Kuntze · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Intsia

At a glance

Occurrence records1 626

Data sources12

Biological traits43

DNA specimens9

eDNA detections7

Sources12 archives

Databases and archives Intsia bijuga's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 626 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Chemical compositionLOTUS · NPASS21 compounds

Occurrence & distributionGBIF1 626 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Intsia bijuga, appelé kohu en Nouvelle-Calédonie, est une espèce végétale de la famille des Caesalpiniaceae, ou des Fabaceae selon la classification phylogénique. C'est un arbre tropical de taille moyenne qui se trouve dans toute la zone pacifique tropicale et équatoriale, du sud-est asiatique aux côtes africaines. Il est également appelé, de même que l'espèce Intsia palembanica, « arbre de fer ».

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology13

Fruit length190 mm

Fruit width56 mm

Leaf length50 mm

Leaf size5 766 mm²

Leaf width34 mm

Petiole length2.9 cm

Plant height35 m

⚠ sources differ — GIFT: 35 m · AusTraits: 30 m · TRY: 28.33 m

Plant height max25 m

Seed length28.5 mm

Seed mass1 328 mg

⚠ sources differ — TRY: 1 328 mg · AusTraits: 1 473 mg · GIFT: 1 473 mg

Seed mass max1 526 mg

Seed mass min1 421 mg

Seed width20 mm

Life cycle & reproduction9

Deciduousnessvariable

Dispersal typewater

Flowering timeyyyyynnnnnny

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Resprouting capacitypartial_resprouting

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formtree

Habitat GIFTdry forest

Leaf compoundnesscompound

Leaf shapeelliptical ovate

Succulenceno

Woodinesswoody

Physiology & chemistry7

Leaf C:N ratio18.1 g/g

Leaf c506 mg/g

Leaf n27.9 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)15.03 mm²/mg

Wood density698 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition21 compounds

Compounds documented for Intsia bijuga across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cyclic peptides4

Flavonols2

Dihydroflavonols1

pteridine alkaloids1

Unsaturated fatty acids1

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(S)-Naringenin	present	LOTUS
3,3',4'5-Tetrahydroxystilbene	present	LOTUS
5-Fluorouracil	present	NPASS
ATGWGHLJNFEABD-UHFFFAOYSA-N	present	NPASS
Axinastatin 5	present	NPASS
beta-Amyrin	present	LOTUS
BICXFXRKSZXLTI-CEQQNCMWSA-N	present	NPASS
dihydromyricetin	present	LOTUS
FXPOPFARHRXCEH-UHFFFAOYSA-N	present	NPASS
Hexacosaenoic acid	present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Intsia bijuga has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes4

GenBank sequences10

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ273853.1 ↗352 bp

ACGT

CAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCAATAGGCCGAGGGCACGTCTGGCTGGGTGTCACACAAAGT …

Intsia bijuga isolate Nk_Ib1 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL★ITS5trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Intsia bijuga carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidypolyploid inferred

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Yeh, M. S., H. YUASA & F. Maekawa. 1986. Chromosome numbers in the Leguminosae. Sci. Rep. Res. Inst. Evol. Biol. 3: 57–71.

CCDB · book-fedorov — Atchison 1951

CCDB · book-fedorov — Berger C. A. et al.1958

CCDB · book-atlas-flowering-plants

n 121×CCDB · Cannon, 2015

CCDB · Cannon, 2015 — Yeh, M.S., H. Yuasa & F. Maekawa., 1986

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 626 records

Wild obs. + sensor444

Museum / vouchered1 017

Cultivated / captive11

Other154

Origin

Native43

Range

Area of Occupancy AOO2 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 96≤1 km 1≤10 km 1>10 km 128

226 georeferenced · 218 without coordinates

Open the mapobservation + sensor444

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 24≤1 km 37≤10 km 74>10 km 6

141 georeferenced · 876 without coordinates

Open the institutions mapphysical evidence1 017

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 11

11 georeferenced

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	139
Saint Louis, US	87
Smithfield, AU	75
Kew, GB	60
Brisbane, AU	47
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	46
Plocation not on record	44
Canberra, AU	31
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	31
Tsukuba, JP	13
Bronx, US	13
DBEVlocation not on record	12
Nishihara, JP	11
Xiamen, CN	10
MeiseBGlocation not on record	9
Honolulu, US	7
Museo Entomologico de Leonlocation not on record	6
St. Paul, US	6
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	6
Fort Worth, US	6
Glocation not on record	6
University of Stellenboschlocation not on record	5
Mount Annan, AU	5
Palmerston, AU	5
Uppsala, SE	4
Université de Strasbourglocation not on record	4
Zürich, CH	3
WAGlocation not on record	2
CASlocation not on record	2
BISHlocation not on record	2
ASUlocation not on record	2
ZTlocation not on record	1
Cincinnati, US	1
Seychelles National Herbariumlocation not on record	1
Taipei, TW	1
Taipei, TW	1
Columbia, US	1
Philadelphia, US	1
TNMlocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Instituto de Investigação Científica Tropicallocation not on record	1
Zlocation not on record	1
BMlocation not on record	1
Llocation not on record	1
Pretoria, ZA	1
Nishihara, JP	1

46 institutions · 714 of 1 017 vouchered records shown · 300 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Intsia bijuga was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.1–22.8

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.4 °C 25.4–27.9

Min temp (night)20.7 °C 16.1–20.7

Precipitation341 mm/mo 80.6–341

Air humidity74.2 % 49.6–74.2

Moisture balance252 mm/mo -63.7–252

Vapour deficit715 Pa 715–1,442

Wind speed2.10 m/s 2.10–3.60

Cloud cover49.9 % 24.5–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Intsia bijuga

At a glance

Sources12 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment12

Physiology & chemistry7

Other traits1

Compound class profile5 classes

Documented compounds21 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 626 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions24 of 46 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 626 records