Inocybe tahquamenonensis

D.E.Stuntz · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Inocybaceae/Inocybe

At a glance

Occurrence records279

Data sources7

Biological traits0

DNA specimens3

eDNA detections54

Sources7 archives

Databases and archives Inocybe tahquamenonensis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility279 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF279 records

Environmental DNA3 datasets · 3 countries54 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Inocybe tahquamenonensis is an inedible species of agaric fungus in the family Inocybaceae. Found in the United States, it was formally described in 1954 by mycologist Daniel E. Stuntz. The fruit bodies have bell-shaped to convex to flattened caps measuring 1.2 – in diameter. Its color is dark purplish brown to reddish- or blackish-brown, with reddish-purple flesh. The gills are attached to the stipe and are somewhat distantly spaced. They are initially reddish brown before turning to chocolate brown, sometimes developing whitish edges. The spore print is brown; spores measure 6–8.5 by 5–6 µm. Fruit bodies grow singly, scattered, or in group under deciduous trees.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Inocybe tahquamenonensis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences8

eDNA detections54

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMT345242.1 ↗227 bp

ACGT

ACTTGGGCAGGCTGTTGCTAGAATGAAATAATTCTGTGCACGCTTGTCATCTTTATGTCTCCACTGTGCACGCATTGTANACTCTGGAAT …

Inocybe tahquamenonensis voucher CNV65 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type279 records

Wild obs. + sensor241

Museum / vouchered38

Range

Area of Occupancy AOO812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 63≤1 km 39≤10 km 45>10 km 41

188 georeferenced · 53 without coordinates

Open the mapobservation + sensor241

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 5≤10 km 8>10 km 1

15 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
TENN-Flocation not on record	10
Bronx, US	5
Davis and Elkins Collegelocation not on record	5
Université de Montréal Biodiversity Centrelocation not on record	5
Chicago, US	4
WTUlocation not on record	3
Denver, US	2
Personal Herbarium of Renee LeBeuflocation not on record	2
Catholic University of Pekinglocation not on record	1

9 institutions · 37 of 38 vouchered records shown · 1 without an institution code

09Environmental DNA54 detections

Where the DNA of Inocybe tahquamenonensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys3

Countries3

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.3 °C 2.90–17.7

Seasonal swing summer↔winter25.3 °C

Max temp (day)19.2 °C 6.40–22.3

Min temp (night)11.0 °C 0.2–14.4

Precipitation140 mm/mo 94.5–156

Air humidity61.5 % 60.2–63.8

Moisture balance19.8 mm/mo 3.10–127

Vapour deficit708 Pa 273–779

Wind speed2.70 m/s 2.10–3.40

Cloud cover50.5 % 43.7–67.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)