Inocybe straminipes

Romagn. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Inocybaceae/Inocybe

At a glance

Occurrence records12

Data sources6

Biological traits0

DNA specimens3

eDNA detections484

Sources6 archives

Databases and archives Inocybe straminipes's data was compiled from.

GBIFGlobal Biodiversity Information Facility12 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI484 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF12 records

Environmental DNA5 datasets · 9 countries484 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Inocybe straminipes has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences5

eDNA detections484

Countries9

The DNA barcodea real sequence read deposited for this species

ITSPP992715.1 ↗498 bpUnited Kingdom

ACGT

GAATGGGCTGTTGCTGGCTCCTCGCATGTGCACGCCTGTCATTTATTTCCCCTCTGTGCACCAACTGTAGGGTCTGGAGTTTTTCAGGTC …

Inocybe straminipes voucher HFRG_EJ230909_2_FRDBI_36569721 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS1

fungal barcode

08Occurrence & distribution

Record type12 records

Wild obs. + sensor3

Museum / vouchered9

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
TENN-Flocation not on record	3

1 institutions · 3 of 9 vouchered records shown · 5 without an institution code

09Environmental DNA484 detections

Where the DNA of Inocybe straminipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found484

Studies independent surveys5

Countries9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 484 detections have coordinates

Open the map9 countries0

NearcticPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 6.00–17.2

Seasonal swing summer↔winter21.7 °C

Max temp (day)19.4 °C 7.70–20.2

Min temp (night)14.2 °C 1.60–14.9

Precipitation84.4 mm/mo 60.8–117

Air humidity62.0 % 59.9–70.2

Moisture balance1.20 mm/mo -62.6–38.8

Vapour deficit740 Pa 283–759

Wind speed2.80 m/s 2.30–7.00

Cloud cover43.7 % 35.5–57.4

CHELSA 1981–2010, ~9 km grid, at location & month of 477 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)