Inocybe salicis

Kühner · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Inocybaceae/Inocybe

At a glance

Occurrence records486

Data sources9

Biological traits0

DNA specimens1

eDNA detections41

Sources9 archives

Databases and archives Inocybe salicis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility486 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI41 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF486 records

Environmental DNA3 datasets · 2 countries41 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Inocybe salicis is an uncommon species of fungus found in association with willow in Europe. The species produces small, brown or yellow mushrooms with caps up to 2.5 cm across, with stems up to 3.5 cm long. The species is similar in appearance to several other closely related species in the genus Inocybe that also associate with willow, and so is most reliably differentiated microscopically.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Inocybe salicis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences7

eDNA detections41

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX241024.1 ↗435 bpSpain · 2023

ACGT

AAAAAAAAAAGATCAGCTTTGCCTCACATCTTCCAGATCTATGTTTTTACAATCTCTCAATGTGTTTTGGAATGTCAAATTGATATATAT …

Inocybe salicis voucher AH 60002 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type486 records

Wild obs. + sensor382

Museum / vouchered104

Range

Area of Occupancy AOO1 036 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 55≤1 km 22≤10 km 296

373 georeferenced · 9 without coordinates

Open the mapobservation + sensor382

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 6≤1 km 20≤10 km 12>10 km 2

40 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence104

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	19
Copenhagen, DK	11
Philadelphia, US	7
Olocation not on record	6
Vancouver, CA	6
WU-MYClocation not on record	6
Karlsruhe, DE	4
Kew, GB	3
Tilburg, NL	3
Görlitz, DE	2
IB FRC Komi SC UB RASlocation not on record	2
CJBGlocation not on record	2
nsnflocation not on record	1
Salzburg, AT	1
Chicago, US	1
Trondheim, NO	1
	1
Uppsala, SE	1
San Sebastián, ES	1
WTUlocation not on record	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
Zürich, CH	1
Berlin, DE	1
LDlocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Mlocation not on record	1
Göteborg, SE	1
Adam Mickiewicz University in Poznańlocation not on record	1

28 institutions · 87 of 104 vouchered records shown · 17 without an institution code

09Environmental DNA41 detections

Where the DNA of Inocybe salicis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found41

Studies independent surveys3

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 41 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 6.10–16.8

Seasonal swing summer↔winter22.3 °C

Max temp (day)19.8 °C 8.80–20.6

Min temp (night)12.7 °C 3.70–14.2

Precipitation84.6 mm/mo 64.7–97.8

Air humidity61.8 % 61.4–67.9

Moisture balance3.70 mm/mo -17.9–49.1

Vapour deficit708 Pa 303–740

Wind speed2.80 m/s 2.50–4.40

Cloud cover43.1 % 37.6–58.4

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)