Inocarpus fagifer

(Parkinson ex F.A.Zorn) Fosberg · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Inocarpus

At a glance

Occurrence records695

Data sources6

Biological traits35

DNA specimens4

eDNA detections2

Sources6 archives

Databases and archives Inocarpus fagifer's data was compiled from.

GBIFGlobal Biodiversity Information Facility695 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF695 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 20

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology13

Fruit length70 mm

Fruit length max100 mm

Fruit width max80 mm

Leaf length220 mm

Leaf length max400 mm

Leaf width max180 mm

Petiole length0.7 cm

Plant height20 m

⚠ sources differ — GIFT: 20 m · AusTraits: 30 m

Plant height max30 m

Seed length max100 mm

Seed length min70 mm

Seed width max80 mm

Seed width min50 mm

Life cycle & reproduction6

Deciduousnessevergreen

Dispersal typewater

Flower colourwhite

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment11

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max700 m

Elevation min2 m

Epiphyteterrestrial

Growth formtree

Leaf compoundnesssimple

Leaf shapeoblong

Succulenceno

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density456 mg/cm³

Other traits2

Plant support typefree-standing

Seeds per fruit1-10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Inocarpus fagifer has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN083707.1 ↗351 bp

ACGT

AGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGG …

Inocarpus fagifer 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Inocarpus fagifer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · book-indian_vol1 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Atchison, E. 1951

CCDB · book-fedorov — Atchison 1951

CCDB · book-atlas-flowering-plants — Atchison 1951

08Occurrence & distribution

Record type695 records

Wild obs. + sensor265

Museum / vouchered404

Other26

Origin

Introduced3

Range

Area of Occupancy AOO1 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 96≤1 km 22≤10 km 17>10 km 21

156 georeferenced · 109 without coordinates

Open the mapobservation + sensor265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 6≤1 km 20≤10 km 45>10 km 13

84 georeferenced · 320 without coordinates

Open the institutions mapphysical evidence404

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	54
Bronx, US	19
Honolulu, US	12
Brisbane, AU	11
Kew, GB	10
University of Stellenboschlocation not on record	9
Auckland, NZ	7
Museo Entomologico de Leonlocation not on record	6
BISHlocation not on record	4
Paris, FR	2
Smithfield, AU	2
Saint Louis, US	2
The University and Jepson Herbarialocation not on record	2
Gump Stationlocation not on record	1
Miami, US	1
St. Paul, US	1
Wlocation not on record	1
St. Augustine, TT	1
Christchurch, NZ	1
Cibinong Science Center, Herbarium Bogorienselocation not on record	1
Palmerston, AU	1
Plocation not on record	1
Rotorua, NZ	1
Bloomington, US	1
University of Hamburglocation not on record	1
Fort Worth, US	1

26 institutions · 153 of 404 vouchered records shown · 251 without an institution code

09Environmental DNA2 detections

Where the DNA of Inocarpus fagifer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.2 °C 24.2–24.2

Seasonal swing summer↔winter0.6 °C

Max temp (day)25.8 °C

Min temp (night)23.1 °C

Precipitation397 mm/mo

Air humidity75.3 %

Moisture balance267 mm/mo

Vapour deficit746 Pa

Wind speed2.20 m/s

Cloud cover61.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)