Inga vera
Willd. · speciesAt a glance
Occurrence records5 326
Data sources10
Biological traits94
DNA specimens15
eDNA detections10
Sources10 archives
Databases and archives Inga vera's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 326 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources94 traits
Occurrence & distributionGBIF5 326 records
Environmental DNA1 datasets · 4 countries10 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 26
01Narrative
Inga inga là một loài thực vật có hoa trong họ Đậu. Loài này được (Vell.) J. Moore miêu tả khoa học đầu tiên năm 1934.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology3
Plant height13 m
⚠ sources differ — GIFT: 13 m · USDA: 14.33 m · TRY: 10.5 m
Plant height max30 m
Seed length14.03 mm
Life cycle & reproduction24
Bloom periodSummer
Coppice potentialYes
Deciduousnessevergreen
Flower colourwhite
Flower conspicuousYes
Fruit seed period beginSpring
Fruit seed period endWinter
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryShort
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment28
Active growth periodFall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsNo
Aquaticterrestrial
BloatNone
Climatewet tropical
Climberself-supporting
Elevation max2 300 m
Elevation mean1 900 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureMedium
Fruit colourbrown
Growth formtree
Growth form USDASingle Crown
Habitat GIFTÁrea Antrópica, Campo Rupestre, Cerrado (lato sensu), Floresta de Igapó, Floresta de Terra Firme, Floresta de Várzea, Floresta Estacional Semidecidual
Hedge toleranceLow
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min36 in
Small grainNo
Woodinesswoody
Physiology & chemistry21
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min365 days
Leaf c484 mg/g
Leaf n28.98 mg/g
Leaf p0.9 mg/g
Moisture useMedium
Nitrogen fixation levelLow
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Precipitation max80 in
Precipitation min39 in
Soil pH max8.5 pH
Soil pH min6 pH
Specific leaf area (SLA)22.13 mm²/mg
Temperature min40 °F
Wood density560 mg/cm³
Uses & economy11
Berry nut seed productNo
Christmas tree productNo
Fodder productNo
Fuelwood productLow
Lumber productYes
Naval store productNo
Nursery stock productNo
Palatable humanYes
Post productYes
Pulpwood productNo
Veneer productYes
Other traits6
Fall conspicuousNo
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr15.24 m
Planting density max640 per acre
Planting density min320 per acre
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Inga vera has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes5
GenBank sequences10
eDNA detections10
Countries5
The DNA barcodea real sequence read deposited for this species
GCCACACGAAAAAGAGCGACCCGCGAACCGGTTGGAACGGAACTCTGAGCGGGGGAGGGCGACGGCCCGCCCGAGGCCTCTCCCGGCAAC …
Inga vera isolate 0701592 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL1★rbcLa★ITS7★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Inga vera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidydiploid inferred
Chromosome records26–262n range26median26mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 263×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · Cave1963
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
CCDB · book-fedorov — Shibata 1962b
CCDB · Cave1963 — Shibata 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 326 records
Wild obs. + sensor1 734
Museum / vouchered3 137
Cultivated / captive1
Other454
Origin
Native669
Range
Area of Occupancy AOO10 272 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 250≤1 km 79≤10 km 27>10 km 46
402 georeferenced · 1 332 without coordinates
Open the mapobservation + sensor1 734
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy92% within 1 km
≤100 m 753≤1 km 58≤10 km 63>10 km 8
882 georeferenced · 2 255 without coordinates
Open the institutions mapphysical evidence3 137
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions79 of 209 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Mexico City, MX | 513 |
| Durango, MX | 382 |
| Saint Louis, US | 240 |
| National Biodiversity Institute, Costa Ricalocation not on record | 121 |
| Tapachula, MX | 87 |
| UFMSlocation not on record | 64 |
| UNESP-FCAlocation not on record | 58 |
| Kew, GB | 58 |
| Laboratorio de Ictiologialocation not on record | 55 |
| Cenargenlocation not on record | 52 |
| Antiguo Cuscatlán, SV | 50 |
| Blumenau, BR | 44 |
| Feira de Santana, BR | 43 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 40 |
| Tuxtla Gutiérrez, MX | 36 |
| Bronx, US | 36 |
| Chaguaramas, TT | 35 |
| Austin, US | 29 |
| San Francisco, US | 28 |
| UEMlocation not on record | 26 |
| Universidad de Antioquia (UdeA)location not on record | 24 |
| Cascavel, BR | 24 |
| Universidade Federal do Vale do São Franciscolocation not on record | 24 |
| Foz do Iguaçu, BR | 24 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 23 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 22 |
| CASlocation not on record | 22 |
| Berlin, DE | 22 |
| JBRJlocation not on record | 21 |
| Chicago, US | 21 |
| UNIVASFlocation not on record | 21 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 21 |
| Ivano-Frankivsk, UA | 20 |
| MEXUlocation not on record | 20 |
| South Kensington, GB | 20 |
| Mérida, MX | 19 |
| Universidad Nacional de Colombia (UNAL)location not on record | 18 |
| Chapingo, MX | 18 |
| San José, CR | 17 |
| Salvador, BR | 17 |
| Brasília, BR | 16 |
| Departamento de Sistematica e Ecologialocation not on record | 16 |
| UFMGlocation not on record | 16 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 16 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 16 |
| UTFPR-CPlocation not on record | 16 |
| Masindi, UG | 15 |
| Cuiabá, BR | 13 |
| ESALQlocation not on record | 12 |
| UNICAMPlocation not on record | 12 |
| UFSCarlocation not on record | 11 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 10 |
| Porto Alegre, BR | 10 |
| USP-IBlocation not on record | 10 |
| San Francisco de Campeche, MX | 10 |
| UNEMATlocation not on record | 9 |
| Universidade Federal de Sergipe (UFS)location not on record | 9 |
| Juriquilla, MX | 8 |
| UnBlocation not on record | 8 |
| Jataí / Setor Industrial, BR | 8 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 8 |
| UFBAlocation not on record | 8 |
| Paris, FR | 8 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 7 |
| Altos de Pipe, VE | 7 |
| ASUlocation not on record | 7 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 7 |
| University of Stellenboschlocation not on record | 7 |
| MAlocation not on record | 7 |
| Stockholm, SE | 7 |
| UTFPR-DVlocation not on record | 7 |
| Tuxtla Gutiérrez, MX | 6 |
| LDlocation not on record | 6 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 6 |
| INMAlocation not on record | 6 |
| Santa Cruz de la Sierra, BO | 6 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 6 |
| UFRRJlocation not on record | 6 |
| EL PASO, US | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| IAPlocation not on record | 5 |
| Guatemala City, GT | 5 |
| IECOSlocation not on record | 5 |
| Museum of Zoologylocation not on record | 5 |
| UFRPElocation not on record | 5 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 5 |
| Tampa, US | 5 |
| UNIVILLElocation not on record | 5 |
| Edinburgh, GB | 5 |
| Maringá, BR | 5 |
| Riverside, US | 5 |
| CEPLAClocation not on record | 5 |
| Universidad de La Salle (La Salle)location not on record | 5 |
| FPMZBlocation not on record | 5 |
| Cruz das Almas, BR | 5 |
| Bogotá, D.C., CO | 4 |
| UFESlocation not on record | 4 |
| Ciudad de México, MX | 4 |
| FUVATESlocation not on record | 4 |
| Provincia di Livornolocation not on record | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| Uberlândia, BR | 4 |
| UNESP-RClocation not on record | 4 |
| BMlocation not on record | 4 |
| Loja, EC | 4 |
| UFVJMlocation not on record | 4 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 4 |
| HUENFlocation not on record | 4 |
| Miami, US | 4 |
| Ural Federal University "B. N. Yeltsin"location not on record | 4 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| Autlán de Navarro, MX | 3 |
| Universidade de São Paulolocation not on record | 3 |
| UTFPR-SLlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Federal University of Espírito Santolocation not on record | 3 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 3 |
| CPATSAlocation not on record | 3 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 3 |
| IPA/SPlocation not on record | 3 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 3 |
| URCAlocation not on record | 3 |
| UNESP-ISlocation not on record | 3 |
| Universiti Sains Malaysialocation not on record | 3 |
| UFABClocation not on record | 3 |
| UNESP-IBILCElocation not on record | 3 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 3 |
| Universidade Federal do Maranhãolocation not on record | 3 |
| QCNElocation not on record | 3 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 3 |
| Austin, US | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Guasave, MX | 2 |
| Universidade Federal de Goiáslocation not on record | 2 |
| Lima, PE | 2 |
| Universidade Paulistalocation not on record | 2 |
| UERJlocation not on record | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| UFSClocation not on record | 2 |
| Universidad de Córdoba (UC)location not on record | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| Santa Teresa, BR | 2 |
| MEDELlocation not on record | 2 |
| UEPAlocation not on record | 2 |
| COLlocation not on record | 2 |
| UNISANTAlocation not on record | 2 |
| Brasília, BR | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| Dekalb, US | 2 |
| OTSlocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 2 |
| Bloomington, US | 2 |
| Fredericksburg, US | 2 |
| Jardim Botânico do Rio de Janeirolocation not on record | 2 |
| NO DISPONIBLElocation not on record | 1 |
| Pondicherry, IN | 1 |
| UNESClocation not on record | 1 |
| Zlocation not on record | 1 |
| Facultad de Biología, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Mérida, MX | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Dirección Nacional Forestal, Ministerio de Agricultura y Ganaderíalocation not on record | 1 |
| Santa Maria, BR | 1 |
| US | 1 |
| Claremont, US | 1 |
| Beijing, CN | 1 |
| UFPIlocation not on record | 1 |
| IAvHlocation not on record | 1 |
| Corrientes, AR | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Iquitos, PE | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Phoenix, US | 1 |
| HUAlocation not on record | 1 |
| UEMAlocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Llocation not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| HEMlocation not on record | 1 |
| Quito, EC | 1 |
| Criciúma, BR | 1 |
| Puebla, MX | 1 |
| Xiamen, CN | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Londrina, BR | 1 |
| Universität Göttingenlocation not on record | 1 |
| San Isidro, AR | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Castelar, AR | 1 |
| Universidade Federal do Oeste da Bahialocation not on record | 1 |
| Fortaleza, BR | 1 |
| Morelia, MX | 1 |
| Jardín Botánico de Cartagena “Guillermo Piñeres”location not on record | 1 |
| Santiago de Cali, CO | 1 |
| Puerto Ayora, EC | 1 |
| UFSJlocation not on record | 1 |
| Ilhéus, BR | 1 |
| New Haven, US | 1 |
| UDESC-CAVlocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Cusco, PE | 1 |
209 institutions · 3 090 of 3 137 vouchered records shown · 44 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Inga vera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.7 °C 25.3–27.0
Seasonal swing summer↔winter3.50 °C
Max temp (day)27.9 °C 27.5–30.4
Min temp (night)23.5 °C 22.0–24.2
Precipitation144 mm/mo 126–201
Air humidity66.4 % 62.8–68.8
Moisture balance10.3 mm/mo
Vapour deficit1,101 Pa 1,017–1,263
Wind speed2.50 m/s
Cloud cover25.9 % 21.4–42.4
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.