Inga thibaudiana
DC. · speciesAt a glance
Occurrence records3 371
Data sources9
Biological traits35
DNA specimens36
eDNA detections36
Sources9 archives
Databases and archives Inga thibaudiana's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 371 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics36 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
WikidataWikimedia Foundationstructured facts↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources35 traits
Occurrence & distributionGBIF3 371 records
Environmental DNA1 datasets · 1 countries36 detections
DNA & barcodingBOLD · NCBI36 specimens
01Narrative
Inga thibaudiana is a species of tropical tree in the family Fabaceae. It occurs in Central and South America, where it is known as guaba de mono, guabito and guavo de playa.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology9
Leaf size4 440 mm²
Plant height15 m
⚠ sources differ — GIFT: 15 m · TRY: 11.23 m
Plant height max30 m
Seed length9.9 mm
Seed length max30 mm
Seed length min6 mm
Seed volume1 467 mm³
Seed volume max1 800 mm³
Seed volume min1 200 mm³
Life cycle & reproduction6
Deciduousnessevergreen
Dispersal typeanimal
Life formtree
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max1 550 m
Elevation min0 m
Epiphyteterrestrial
Growth formtree
Habitat GIFTÁrea Antrópica, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Terra Firme, Floresta Ombrófila (= Floresta Pluvial)
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry9
Ldmc max452 mg/g
Ldmc min452 mg/g
Leaf dry-matter content (LDMC)421 mg/g
⚠ sources differ — TRY: 421 mg/g · GIFT: 452 mg/g
Leaf n28.96 mg/g
Leaf p0.864 mg/g
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)15.9 mm²/mg
Wood density514 mg/cm³
05DNA & barcoding36 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Inga thibaudiana has left across the world's sequence archives.
At a glance
DNA specimens36
Marker genes4
GenBank sequences10
eDNA detections36
Countries3
The DNA barcodea real sequence read deposited for this species
GCCACACAAAAAAGAGCGACCCGCGAACCGGTTGGAACGGAACTCTGAGCGGGGGAGGGCGACGGCCCGCCCGAGGCCTCTCCCGGCAAC …
Inga thibaudiana isolate 0604685 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL1★ITS5★ITS2
plant barcodefungal barcode
08Occurrence & distribution
Record type3 371 records
Wild obs. + sensor871
Museum / vouchered2 500
Origin
Native540
Range
Area of Occupancy AOO5 420 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy85% within 1 km
≤100 m 105≤1 km 5≤10 km 4>10 km 16
130 georeferenced · 741 without coordinates
Open the mapobservation + sensor871
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy30% within 1 km
≤100 m 10≤1 km 25≤10 km 59>10 km 24
118 georeferenced · 2 382 without coordinates
Open the institutions mapphysical evidence2 500
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions51 of 146 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 399 |
| Bronx, US | 230 |
| Kew, GB | 96 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 89 |
| Salvador, BR | 81 |
| JBRJlocation not on record | 81 |
| Universidad de Antioquia (UdeA)location not on record | 71 |
| Chaguaramas, TT | 62 |
| Laboratorio de Ictiologialocation not on record | 56 |
| National Biodiversity Institute, Costa Ricalocation not on record | 55 |
| Departamento de Sistematica e Ecologialocation not on record | 44 |
| UFBAlocation not on record | 42 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 42 |
| University of Stellenboschlocation not on record | 38 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 37 |
| Feira de Santana, BR | 37 |
| MAlocation not on record | 36 |
| Universiti Sains Malaysialocation not on record | 35 |
| Chicago, US | 33 |
| La Paz, BO | 33 |
| UFRPElocation not on record | 32 |
| CEPLAClocation not on record | 31 |
| Museum of Zoologylocation not on record | 29 |
| QCNElocation not on record | 26 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 25 |
| Mexico City, MX | 23 |
| IECOSlocation not on record | 21 |
| Masindi, UG | 19 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 19 |
| Universidad Nacional de Colombia (UNAL)location not on record | 19 |
| UNEMATlocation not on record | 17 |
| Cuiabá, BR | 16 |
| Santa Cruz de la Sierra, BO | 16 |
| San José, CR | 16 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 15 |
| Universidade Federal de Sergipe (UFS)location not on record | 15 |
| UEPAlocation not on record | 15 |
| HUT Culture Collectionlocation not on record | 14 |
| CASlocation not on record | 13 |
| Universidad Nacional Federico Villarreallocation not on record | 13 |
| Paris, FR | 13 |
| ASUlocation not on record | 13 |
| UFMGlocation not on record | 12 |
| UnBlocation not on record | 11 |
| Durham, US | 11 |
| UFPElocation not on record | 11 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 10 |
| Iquitos, PE | 10 |
| Museu Paraense Emílio Goeldilocation not on record | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 9 |
| Cenargenlocation not on record | 9 |
| Quito, EC | 9 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 9 |
| UNESP-FCAlocation not on record | 9 |
| Lima, PE | 8 |
| Brasília, BR | 8 |
| Universidade Federal do Maranhãolocation not on record | 8 |
| UEMAlocation not on record | 7 |
| UFPRlocation not on record | 7 |
| UFESlocation not on record | 7 |
| Chongqing Museumlocation not on record | 6 |
| León, NI | 6 |
| Plocation not on record | 6 |
| Fort Worth, US | 6 |
| UFSCarlocation not on record | 5 |
| INMAlocation not on record | 5 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 5 |
| USP-IBlocation not on record | 5 |
| Universidad Católica de Oriente (UCO)location not on record | 5 |
| Universidade Federal do Espírito Santolocation not on record | 5 |
| Santa Teresa, BR | 5 |
| Ann Arbor, US | 5 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| Stockholm, SE | 4 |
| Provincia di Livornolocation not on record | 4 |
| Cusco, PE | 4 |
| Durango, MX | 4 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 4 |
| IPA/SPlocation not on record | 4 |
| UTPLlocation not on record | 4 |
| LDlocation not on record | 4 |
| Brasília, BR | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 3 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 3 |
| Aarhus, DK | 3 |
| UFSClocation not on record | 3 |
| Edinburgh, GB | 3 |
| Santarém, BR | 3 |
| Ivano-Frankivsk, UA | 3 |
| Mérida, MX | 3 |
| UFRRJlocation not on record | 3 |
| Loja, EC | 3 |
| arosemena tola, EC | 3 |
| Cochabamba, BO | 3 |
| Seropédica, BR | 3 |
| Universidade Paulistalocation not on record | 3 |
| HUAlocation not on record | 3 |
| Institut de Recherche pour le Developpement (IRD)location not on record | 3 |
| Universidad de los Llanos (UniLlanos)location not on record | 3 |
| Anton de Kom University of Surinamelocation not on record | 3 |
| UTFPR-CPlocation not on record | 2 |
| Porto Alegre, BR | 2 |
| Corrientes, AR | 2 |
| UNICAMPlocation not on record | 2 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 2 |
| UNICAPlocation not on record | 2 |
| HUENFlocation not on record | 2 |
| Sucre, BO | 2 |
| Ilhéus, BR | 2 |
| Campo Mourão, BR | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| URCAlocation not on record | 2 |
| Tapachula, MX | 2 |
| Cambridge, US | 1 |
| South Kensington, GB | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| COLlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Provincial Museum of Albertalocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Wlocation not on record | 1 |
| Arequipa, PE | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Calabar, NG | 1 |
| ESALQlocation not on record | 1 |
| Universidade Federal do Vale do São Franciscolocation not on record | 1 |
| San Francisco, US | 1 |
| Instituto Nacional de Biodiversidad del Ecuadorlocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| Richmond, US | 1 |
| GeoPark Colombia S.A.S (GeoPark)location not on record | 1 |
| UFVJMlocation not on record | 1 |
| Xiamen, CN | 1 |
| UNESP-IBILCElocation not on record | 1 |
| CJBGlocation not on record | 1 |
| UESBlocation not on record | 1 |
| OTSlocation not on record | 1 |
| UFMSlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| UNIVASFlocation not on record | 1 |
| Tampa, US | 1 |
146 institutions · 2 402 of 2 500 vouchered records shown · 64 without an institution code
09Environmental DNA36 detections
Where the DNA of Inga thibaudiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found36
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 36 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.7 °C 25.7–25.7
Seasonal swing summer↔winter1.30 °C
Max temp (day)29.1 °C
Min temp (night)22.4 °C
Precipitation144 mm/mo
Air humidity68.5 %
Moisture balance17.9 mm/mo
Vapour deficit1,043 Pa
Wind speed0.8 m/s
Cloud cover57.9 %
CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.