Inga cordistipula

Mart. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Inga

At a glance

Occurrence records71

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Inga cordistipula's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility71 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF71 records

DNA & barcodingNCBIsequences

01Narrative

Inga cordistipula is a species of tree in the family Fabaceae. It was described by German botanist Carl Friedrich Philipp von Martius. It can be found in Colombia and Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Leaf size3 000 mm²

Plant height max5 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)

Woodinesswoody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Inga cordistipula has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMZ927383.1 ↗732 bp

ACGT

ACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTG …

Inga cordistipula voucher D. Cardoso 2352 (HUEFS) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type71 records

Wild obs. + sensor14

Museum / vouchered57

Origin

Native11

Range

Area of Occupancy AOO128 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 12 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence57

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	13
JBRJlocation not on record	12
Chicago, US	6
Laboratorio de Ictiologialocation not on record	5
San Jose State University, Museum of Birds and Mammalslocation not on record	4
Feira de Santana, BR	3
Kew, GB	2
Mexico City, MX	2
UNESP-FCAlocation not on record	2
Seropédica, BR	1
UFRRJlocation not on record	1
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	1
INMAlocation not on record	1
Saint Louis, US	1
Universidad Nacional Federico Villarreallocation not on record	1
UFMGlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1

17 institutions · 57 of 57 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)