Indocalamus latifolius

(Keng) McClure · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Indocalamus

At a glance

Occurrence records201

Data sources9

Biological traits11

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Indocalamus latifolius's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF201 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Indocalamus latifolius is an East Asian species of bamboo in the genus Indocalamus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height3 m

Life cycle & reproduction3

Deciduousnessdeciduous

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indocalamus latifolius has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ464824.1 ↗582 bp

ACGT

GGAAGGAGAAGTCGTAACAAGGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTACACTACCGGCCTAACCCGCCGGCTATGTAT …

UNVERIFIED_ORG: Indocalamus latifolius 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Indocalamus latifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidypolyploid inferred

Chromosome records48–482n range48median48mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 484×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Chen, R. y. & W. x. Zong. 1991. Chromosome numbers of some scattered bamboos. Acta Phytotax. Sin. 29(5): 452–455.

CCDB · ipcn-api-dl — Fang, W., J. r. Wu & Y. c. Sheng. 1991. Chromosome number of ten species of scattered bamboos. J. Zhejiang Forest. Coll. 8(1): 127–130.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type201 records

Wild obs. + sensor1

Museum / vouchered200

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 200 records without

Open the institutions mapphysical evidence200

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zhengzhou, CN	41
nlocation not on record	30
Nanjing, CN	24
Changsha, CN	16
Nanjing, CN	13
Xian, CN	11
Chengdu, CN	9
Beijing, CN	8
Hangzhou, CN	7
Zhejiang Museum of Natural Historylocation not on record	6
Central China Normal Universitylocation not on record	6
Awka, NG	4
Shanghai, CN	3
Guiyang, CN	3
Shanghai, CN	3
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
Xian, CN	2
Wuhan, CN	2
SCAUlocation not on record	2
Guilin, CN	1
Xiamen, CN	1
Jiujiang Forestry Institutelocation not on record	1
Yangling, CN	1
Ischia Marine Centrelocation not on record	1
Jishou Universitylocation not on record	1
Chongqing, CN	1

26 institutions · 199 of 200 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Indocalamus latifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)