Indigofera szechuensis

Craib · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Indigofera

At a glance

Occurrence records206

Data sources8

Biological traits6

DNA specimens7

eDNA detections7

Sources8 archives

Databases and archives Indigofera szechuensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF206 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 16

01Narrative

甘肃木蓝（学名：），为豆科木蓝属下的一个植物种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Plant height1.25 m

Life cycle & reproduction2

Deciduousnessdeciduous

Life formshrub

Habitat & environment3

Climatetemperate

Growth formshrub

Woodinesswoody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indigofera szechuensis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections7

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM983272.1 ↗582 bpChina

ACGT

GATGCCTCAAGCAATCCGACTCGTGAACATGTTTGCTTACTTGGGGTTGGTTTGGCGTGTGAAAACACGACTGCCTCCCCTGGCGCAGGA …

Indigofera szechuensis voucher GXF9449-2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Indigofera szechuensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · Cave1962

CCDB · Cave1962 — Frahm-Leliveld 1962a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.948 ↗

08Occurrence & distribution

Record type206 records

Museum / vouchered204

Other2

Range

Area of Occupancy AOO192 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 204 records without

Open the institutions mapphysical evidence204

10Collections & institutions

Holding institutions14 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	78
Guangzhou, CN	41
Nanjing, CN	26
Chengdu, CN	19
CASlocation not on record	10
Xian, CN	6
GZFlocation not on record	4
Chengdu, CN	4
South Kensington, GB	4
Cambridge, US	2
Guilin, CN	2
WNNUlocation not on record	2
Nanjing, CN	2
Kunming, CN	1
Chicago, US	1
Uppsala, SE	1
Saint Louis, US	1

17 institutions · 204 of 204 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Indigofera szechuensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)