Indigofera suffruticosa
Mill. · speciesAt a glance
Occurrence records5 954
Data sources14
Biological traits52
DNA specimens32
eDNA detections17
Sources14 archives
Databases and archives Indigofera suffruticosa's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 950 records↗
OBISOcean Biodiversity Information System4 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics32 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources52 traits
Chemical compositionLOTUS · NPASS13 compounds
Occurrence & distributionGBIF · OBIS5 954 records
Environmental DNA1 datasets · 4 countries17 detections
DNA & barcodingBOLD · NCBI32 specimens
Genome at a glanceCCDB · GIFT2n = 16
01Narrative
Indigofera suffruticosa, l’indigotier ou indigo bâtard, est une espèce de plantes à fleurs de la famille des Fabacées. C'est un arbrisseau originaire d'Amérique tropicale. Tout comme l'espèce apparentée, l'indigo des teinturiers, ses feuilles sont utilisées pour la préparation de la teinture d'indigo.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology26
Fruit length14 mm
Fruit length max20 mm
Fruit length min15 mm
Fruit width3 mm
Fruit width max3 mm
Fruit width min2 mm
Inflorescence length max4 cm
Inflorescence length min2 cm
Leaf length32 mm
Leaf length max38 mm
Leaf length min10 mm
Leaf width5 mm
Leaf width max15 mm
Leaf width min3 mm
Petiole length1.35 cm
Plant height1.5 m
⚠ sources differ — GIFT: 1.5 m · AusTraits: 1.88 m · TRY: 1.5 m
Plant height max2.5 m
Plant height min2 m
Seed length1.5 mm
Seed length max2 mm
Seed length min1.7 mm
Seed mass3.12 mg
Seed mass max3.56 mg
Seed mass min2.6 mg
Seed width max1.5 mm
Seed width min1.2 mm
Life cycle & reproduction7
Dehiscencedehiscent
Dispersal type detailedanthropochorous
Flower colourpink
Flowering timeyyyyyyynnnnn
Life formperennial, subshrub or shrub
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 700 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typelegume
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: herb subshrub · TRY: Shrub
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Cerrado (lato sensu), Restinga
Leaf compoundnesscompound
Leaf shapeelliptical narrowly_obovate
Succulenceno
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: non-woody
Physiology & chemistry2
Nitrogen fixingnitrogen_fixer
Photosynthetic pathwayC3
Other traits2
Seeds per fruit1-10
Shoot orientationerect
03Chemical composition13 compounds
Compounds documented for Indigofera suffruticosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Simple indole alkaloids2
Stigmastane steroids2
Simple oxindole alkaloids2
Purine alkaloids2
Aminoacids1
Documented compounds13 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3S)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,3-dihydroindol-2-one | present | LOTUS | |
| (3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol | present | LOTUS | |
| (S)-(+)-allantoin | present | LOTUS | |
| 2-Hydroxy-9,11,14,14-tetramethyl-6-phenyl-7,12-dioxatetracyclo[7.4.1.02,11.03,8]tetradec-3(8)-ene-4,10-dione | present | LOTUS | |
| 3-Nitropropionic acid | present | LOTUS | |
| 4-O-(3-nitropropanoyl)corollin | present | LOTUS | |
| Canavanine | present | LOTUS | |
| Coronarian | present | LOTUS | |
| FD&C blue 2 | present | LOTUS | |
| Indoxyl-beta-D-glucoside | present | LOTUS |
05DNA & barcoding32 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indigofera suffruticosa has left across the world's sequence archives.
At a glance
DNA specimens32
Marker genes5
GenBank sequences10
eDNA detections17
Countries6
The DNA barcodea real sequence read deposited for this species
CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTCAAGAAACCCGACTCGCGAACATGTTTGCTTACTCGGGGTTGGC …
Indigofera suffruticosa voucher ZXL235-5 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Indigofera suffruticosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records12–322n range16median16mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1611×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +4
CCDB · ipcn-api-dl — GUPTA, P. K. & K. Agarwal. 1982. Cytological studies in the genus Indigofera L. Cytologia 47: 665–681.
CCDB · ipcn-api-dl — Pinto-Magiio, C. A. F., N. L. Pierozzi, S. C. P. Castro & M. D. Soares-Scott. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 23–24.
CCDB · ipcn-api-dl — Molero, J., A. Rovira, J. Simón, R. Duré & D. Franco. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 22–24.
CCDB · ipcn-api-dl — Fernandez, A. 1977. Numeros cromosomicos en Angiospermas. Hickenia 1: 83–86.
CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.
CCDB · book-ipcn67-71 — SINGH, A., & R.P. ROY. 1970. Karylogical studies in Triqonella, Indiqofera, and Phaseolus. Nucleus 13: 41-54.
CCDB · book-ipcn75-78 — Fernandez 1977
CCDB · book-indian_vol1 — Frahm-Leliveld, J.A. 1957, 1960a ; Krapovickas, A. & Krapovickas, A.M.F. 1957 ; Chuang, T.I. et al. 1963 ; Roy, R.P. & Singh, A. 1969 ; Singh, A. & Roy, R.P. 1970
CCDB · Cave1957 — Krapov. & Fuchs de K.
CCDB · iapt — IAPT/IOPB Chromosome Data 30
GIFT · GIFT (floras)
2n 124×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +1
CCDB · ipcn-api-dl — Reddy, V. R. K. 1989. Karyomorphological studies in Indigofera and Trifolium. J. Cytol. Genet. 24: 30–35.
CCDB · book-indian_vol1 — Senn, H.A. 1938
CCDB · book-fedorov — Senn 1938b
GIFT · GIFT (floras)
2n 323×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
CCDB · book-indian_vol1 — Kawakami, I. 1930 ; Shibata, K. 1962b
GIFT · GIFT (floras)
n 83×CCDB · ipcn-api-dl · CCDB · Cave1957
CCDB · ipcn-api-dl — GUPTA, P. K. & K. Agarwal. 1982. Cytological studies in the genus Indigofera L. Cytologia 47: 665–681.
CCDB · ipcn-api-dl — Coleman, J. R. & E. M. Demenezes. 1980. Chromosome numbers in Leguminosae from the State of Sao Paulo, Brazil. Rhodora 82: 475–481.
CCDB · Cave1957 — Frahm-Leliveld
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 954 records
Wild obs. + sensor945
Museum / vouchered4 844
Cultivated / captive21
Other144
Origin
Native816
Introduced5
Range
Area of Occupancy AOO14 092 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 381≤1 km 163≤10 km 55>10 km 57
656 georeferenced · 289 without coordinates
Open the mapobservation + sensor945
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy71% within 1 km
≤100 m 608≤1 km 91≤10 km 214>10 km 75
988 georeferenced · 3 856 without coordinates
Open the institutions mapphysical evidence4 844
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 1
1 georeferenced · 20 without coordinates
Open the mapnot free-living21
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions160 of 342 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 488 |
| Durango, MX | 307 |
| Bronx, US | 266 |
| Mexico City, MX | 185 |
| Chicago, US | 161 |
| Laboratorio de Ictiologialocation not on record | 118 |
| UNIVASFlocation not on record | 110 |
| Kew, GB | 108 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 85 |
| Taipei, TW | 79 |
| Austin, US | 73 |
| Guangzhou, CN | 71 |
| University of Stellenboschlocation not on record | 71 |
| Salvador, BR | 63 |
| Brisbane, AU | 63 |
| Porto Alegre, BR | 59 |
| UFMSlocation not on record | 55 |
| JBRJlocation not on record | 43 |
| Mérida, MX | 43 |
| Ann Arbor, US | 42 |
| National Biodiversity Institute, Costa Ricalocation not on record | 40 |
| Universidad Nacional de Colombia (UNAL)location not on record | 39 |
| Paris, FR | 38 |
| UFBAlocation not on record | 38 |
| Chaguaramas, TT | 38 |
| Guilin, CN | 36 |
| Museo Entomologico de Leonlocation not on record | 32 |
| Beijing, CN | 31 |
| Istituto Agrario Castelnuovolocation not on record | 30 |
| Tampa, US | 29 |
| San Isidro, AR | 29 |
| UFRPElocation not on record | 28 |
| Universidad de Antioquia (UdeA)location not on record | 28 |
| Smithfield, AU | 28 |
| Departamento de Sistematica e Ecologialocation not on record | 27 |
| Universidade Federal do Vale do São Franciscolocation not on record | 27 |
| Cenargenlocation not on record | 27 |
| UNICAMPlocation not on record | 27 |
| UFERSAlocation not on record | 25 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 25 |
| Antiguo Cuscatlán, SV | 25 |
| Corrientes, AR | 22 |
| USP-IBlocation not on record | 22 |
| Blumenau, BR | 22 |
| Chapingo, MX | 22 |
| Xiamen, CN | 21 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 21 |
| Brasília, BR | 20 |
| Aarhus, DK | 20 |
| UnBlocation not on record | 19 |
| CEPLAClocation not on record | 19 |
| Miami, US | 18 |
| Guangzhou, CN | 18 |
| Riverside, US | 18 |
| UFPElocation not on record | 18 |
| San Diego, US | 17 |
| León, NI | 17 |
| Universidad de Caldas (UCaldas)location not on record | 16 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 16 |
| Ciudad de México, MX | 16 |
| Austin, US | 16 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 16 |
| Santa Cruz de la Sierra, BO | 15 |
| Paleontological Collectionlocation not on record | 15 |
| Kunming, CN | 15 |
| Berlin, DE | 15 |
| Loja, EC | 15 |
| BISHlocation not on record | 15 |
| CNF-UFHBlocation not on record | 15 |
| ASUlocation not on record | 14 |
| Brasília, BR | 14 |
| CPATSAlocation not on record | 14 |
| Feira de Santana, BR | 14 |
| Texas Lutheran Universitylocation not on record | 13 |
| MeiseBGlocation not on record | 13 |
| Fortaleza, BR | 13 |
| Masindi, UG | 13 |
| Tapachula, MX | 13 |
| Altos de Pipe, VE | 12 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 12 |
| Flagstaff, US | 12 |
| Tlalnepantla, MX | 12 |
| Juriquilla, MX | 11 |
| Honolulu, US | 11 |
| CASlocation not on record | 10 |
| Nishihara, JP | 10 |
| UEMlocation not on record | 10 |
| Tuxtla Gutiérrez, MX | 10 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 10 |
| Culiacán, MX | 9 |
| South Kensington, GB | 9 |
| Canberra, AU | 9 |
| Ivano-Frankivsk, UA | 9 |
| Universidad Industrial de Santander (UIS)location not on record | 9 |
| UFESlocation not on record | 9 |
| Cusco, PE | 8 |
| Mount Annan, AU | 8 |
| Universidade Federal de Sergipe (UFS)location not on record | 8 |
| Taipei, TW | 8 |
| Auckland, NZ | 8 |
| Mérida, MX | 8 |
| UNESP-FCAlocation not on record | 8 |
| HACAMlocation not on record | 8 |
| Stockholm, SE | 8 |
| Hermosillo, MX | 8 |
| TAIElocation not on record | 8 |
| Fort Worth, US | 8 |
| MAlocation not on record | 7 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 7 |
| San José, CR | 7 |
| Castelar, AR | 7 |
| Federal University of Espírito Santolocation not on record | 7 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| Universiti Sains Malaysialocation not on record | 7 |
| URCAlocation not on record | 7 |
| IPA/SPlocation not on record | 7 |
| Tsukuba, JP | 7 |
| LDlocation not on record | 7 |
| Córdoba, AR | 7 |
| UNESClocation not on record | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| Montréal, CA | 6 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 6 |
| Cambridge, US | 6 |
| INMAlocation not on record | 6 |
| Bogotá, D.C., CO | 6 |
| Chengdu, CN | 6 |
| Christchurch, NZ | 6 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 6 |
| MEXUlocation not on record | 6 |
| Maringá, BR | 6 |
| Giardini Botanici Hanburylocation not on record | 6 |
| Palmerston, AU | 5 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| Cruz das Almas, BR | 5 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 5 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 5 |
| HNBlocation not on record | 5 |
| HUT Culture Collectionlocation not on record | 5 |
| Universidad Nacional de Asunciónlocation not on record | 5 |
| UTFPR-CPlocation not on record | 5 |
| Yunnan Universitylocation not on record | 5 |
| Universidade Federale do Rio Grande do Sullocation not on record | 5 |
| IBANNlocation not on record | 5 |
| Campo Mourão, BR | 5 |
| Area de Conservacion Guanacastelocation not on record | 5 |
| Linares, MX | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Université de Strasbourglocation not on record | 5 |
| UESBlocation not on record | 5 |
| Universidad del Valle (UniValle)location not on record | 4 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 4 |
| ESALQlocation not on record | 4 |
| BMlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Quito, EC | 4 |
| Puerto Ayora, EC | 4 |
| Sangmiung Universitylocation not on record | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| Foz do Iguaçu, BR | 4 |
| Santa Teresa, BR | 4 |
| UNIVILLElocation not on record | 4 |
| QCNElocation not on record | 4 |
| La Paz, MX | 4 |
| Phoenix, US | 4 |
| UFSClocation not on record | 4 |
| UFOPlocation not on record | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| UTPLlocation not on record | 4 |
| Burlington, US | 4 |
| Universidade de São Paulolocation not on record | 4 |
| Changsha, CN | 4 |
| Edinburgh, GB | 4 |
| Guiyang, CN | 3 |
| Wuhan, CN | 3 |
| Nagasaki University - Fisherieslocation not on record | 3 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 3 |
| Dekalb, US | 3 |
| Criciúma, BR | 3 |
| La Paz, BO | 3 |
| Puebla, MX | 3 |
| Museu Paraense Emílio Goeldilocation not on record | 3 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 3 |
| Londrina, BR | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| EL PASO, US | 3 |
| Wuzhou, CN | 3 |
| FUVATESlocation not on record | 3 |
| Durban, ZA | 3 |
| Museum of Zoologylocation not on record | 3 |
| US | 3 |
| Nanjing, CN | 3 |
| Mexico City, MX | 3 |
| Chongqing Museumlocation not on record | 3 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| The University of Arizonalocation not on record | 3 |
| Fredericksburg, US | 2 |
| Seoul, KR | 2 |
| UNESP-ISlocation not on record | 2 |
| UNESP-RClocation not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| FJIDClocation not on record | 2 |
| ESP004location not on record | 2 |
| Seychelles National Herbariumlocation not on record | 2 |
| Universidad Nacional Federico Villarreallocation not on record | 2 |
| Sucre, BO | 2 |
| SCAUlocation not on record | 2 |
| HUAlocation not on record | 2 |
| Chapel Hill, US | 2 |
| R. Barneby (NY), 1991location not on record | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Universidade Federal do Maranhãolocation not on record | 2 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 2 |
| UFMGlocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Ilhéus, BR | 2 |
| Jiangxi Universitylocation not on record | 2 |
| Taipei, TW | 2 |
| UEPAlocation not on record | 2 |
| IECOSlocation not on record | 2 |
| Odawara, JP | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Mazatlán, MX | 2 |
| Uppsala, SE | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| Cochabamba, BO | 2 |
| Lima, PE | 2 |
| Barcelona, ES | 2 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 2 |
| Plocation not on record | 2 |
| Wuhan, CN | 2 |
| Jardim Botânico do Rio de Janeirolocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Madison, US | 2 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 2 |
| Nishihara, JP | 2 |
| Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record | 2 |
| Iquitos, PE | 1 |
| Wlocation not on record | 1 |
| Centro Cultural Santo Domingolocation not on record | 1 |
| Indiana University Southeastlocation not on record | 1 |
| Autlán de Navarro, MX | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Montpellier, FR | 1 |
| UFPIlocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| LGlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Guiyang, CN | 1 |
| Elocation not on record | 1 |
| nlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Davis, US | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Santa Maria, BR | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
| FJFClocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Calabar, NG | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| FLASlocation not on record | 1 |
| US | 1 |
| MEDELlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Mexico City, MX | 1 |
| Awka, NG | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| TNMlocation not on record | 1 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 1 |
| Badajoz, ES | 1 |
| Instituto de Investigação Científica Tropicallocation not on record | 1 |
| Provincial Museum of Albertalocation not on record | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Tuscaloosa, US | 1 |
| HUENFlocation not on record | 1 |
| UFSMlocation not on record | 1 |
| Yangling, CN | 1 |
| Nanjing, CN | 1 |
| UFSCarlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Lake Charles, US | 1 |
| UEMAlocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Knoxville, US | 1 |
| Pretoria, ZA | 1 |
| Toronto, CA | 1 |
| Bangkok, TH | 1 |
| Toluca, MX | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Mexico City, MX | 1 |
| Edmonton, CA | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| INIREBlocation not on record | 1 |
| Hangzhou, CN | 1 |
| OTSlocation not on record | 1 |
| Minia, EG | 1 |
| Valparaiso, CL | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| MSB-2797location not on record | 1 |
| Chengdu, CN | 1 |
| BAYLUlocation not on record | 1 |
| Albuquerque, US | 1 |
| Jackson, US | 1 |
| San Francisco, US | 1 |
| Glocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Adelaide, AU | 1 |
| Uberlândia, BR | 1 |
| Pelotas, BR | 1 |
| Universidade Paulistalocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Bloomington, US | 1 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 1 |
| Vancouver, CA | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Cincinnati, US | 1 |
| Little Rock, US | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Los Angeles, US | 1 |
| Chadron, US | 1 |
| Universidade Federal do Oeste da Bahialocation not on record | 1 |
| Williamsburg, US | 1 |
| Claremont, US | 1 |
| Salamanca, ES | 1 |
| PUC-RSlocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Columbia, US | 1 |
| Cuiabá, BR | 1 |
| University of Oxfordlocation not on record | 1 |
342 institutions · 4 629 of 4 844 vouchered records shown · 209 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Indigofera suffruticosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.4 °C 22.9–25.7
Seasonal swing summer↔winter2.50 °C
Max temp (day)27.9 °C 27.0–30.0
Min temp (night)21.3 °C 16.4–23.4
Precipitation164 mm/mo 27.9–244
Air humidity64.0 % 51.0–69.0
Moisture balance32.9 mm/mo -104–100
Vapour deficit1,145 Pa 946–1,217
Wind speed2.50 m/s 1.20–5.90
Cloud cover37.3 % 21.2–46.4
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.