Indigofera hendecaphylla

Jacq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Indigofera

At a glance

Occurrence records955

Data sources10

Biological traits27

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Indigofera hendecaphylla's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility955 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources27 traits

Occurrence & distributionGBIF955 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Indigofera hendecaphylla, the creeping indigo or trailing indigo, is a species of flowering plant in the family Fabaceae. It is native to the Old World Tropics and Subtropics, and has been introduced to various locales, including Japan and Australia. It was widely introduced as a forage plant when it was thought to be conspecific with Indigofera spicata, and then shown to be toxic to nearly all livestock, with some uncertainty as to which species was tested.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology10

Fruit length24.5 mm

Fruit width2.35 mm

Leaf length10.5 mm

Leaf width4.75 mm

Plant height0.5 m

Seed length1.45 mm

Seed mass2.01 mg

Seed mass max2.1 mg

Seed mass min2.1 mg

Seed width1.2 mm

Life cycle & reproduction3

Life formperennial or subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max137 m

Elevation mean2 500 m

Elevation min30 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: subshrub · TRY: Herb

Leaf compoundnesscompound

Leaf shapeelliptical obovate

Woodinesswoody

⚠ sources differ — AusTraits: woody · GIFT: non-woody

Physiology & chemistry2

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indigofera hendecaphylla has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKM983181.1 ↗597 bpChina

ACGT

GATGCCTCACAAGCAATCGAACTCGTGAACATGTTTGCTTACTTTGGGTTGGTTTGGAGTGTGAAAACACGCCTACCTCCCAAGGGCTAG …

Indigofera hendecaphylla voucher GXF11036 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Indigofera hendecaphylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidydiploid inferred

Chromosome records32–362n range32median32mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 324×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +1

CCDB · book-ipcn65 — Tixier 1965

CCDB · ipcn-api-dl — GUPTA, P. K. & K. Agarwal. 1982. Cytological studies in the genus Indigofera L. Cytologia 47: 665–681.

CCDB · book-indian_vol1 — Frahm-Leliveld, J.A. 1953, 1957 ; Simmonds, N.W. 1954

CCDB · Cave1957 — Frahm-Leliveld

2n 361×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Kishore, H. 1951

n 81×CCDB · Cave1956

CCDB · Cave1956 — Turner b

n 161×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — GUPTA, P. K. & K. Agarwal. 1982. Cytological studies in the genus Indigofera L. Cytologia 47: 665–681.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.952 ↗

08Occurrence & distribution

Record type955 records

Wild obs. + sensor641

Museum / vouchered307

Other7

Origin

Native5

Range

Area of Occupancy AOO2 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 313≤1 km 93≤10 km 19>10 km 30

455 georeferenced · 186 without coordinates

Open the mapobservation + sensor641

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 11≤1 km 5≤10 km 10>10 km 6

32 georeferenced · 275 without coordinates

Open the institutions mapphysical evidence307

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	43
Paris, FR	35
MeiseBGlocation not on record	33
Kew, GB	20
HNBlocation not on record	18
Saint Louis, US	13
Museo Entomologico de Leonlocation not on record	10
Brisbane, AU	6
University of Stellenboschlocation not on record	5
Xiamen, CN	5
Cape Town, ZA	4
Universiti Sains Malaysialocation not on record	3
Mount Annan, AU	3
Nishihara, JP	3
Chicago, US	3
TAIElocation not on record	2
Cusco, PE	2
Canberra, AU	2
CJBGlocation not on record	2
Moscow State Universitylocation not on record	1
MSB-3054location not on record	1
Tuscaloosa, US	1
Bronx, US	1
Tempe, US	1
Smithfield, AU	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
Stockholm, SE	1
Herbier National du Gabonlocation not on record	1
Sendai, JP	1
AUAlocation not on record	1
Yangling, CN	1
WAGlocation not on record	1
Glocation not on record	1
Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record	1
Durban, ZA	1
Bloomington, US	1
Zürich, CH	1
CASlocation not on record	1
LBVlocation not on record	1
Gump Stationlocation not on record	1

40 institutions · 233 of 307 vouchered records shown · 74 without an institution code

09Environmental DNA1 detections

Where the DNA of Indigofera hendecaphylla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)