Indigofera cordifolia

B.Heyne ex Roth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Indigofera

At a glance

Occurrence records274

Data sources10

Biological traits14

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Indigofera cordifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility274 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources14 traits

Occurrence & distributionGBIF274 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Indigofera cordifolia, the heart-leaf indigo, is a species of flowering plant in the family Fabaceae. It is found from the Cape Verde Islands, across the Sahel to Oman, the Indian Subcontinent, Guangdong in China, and some of the islands of Indonesia, and it has been introduced to the Northern Territory of Australia. A glycophyte adapted to sandy soils, it is considered a weed in some situations, but can also improve crop yields due to its nitrogen-fixing ability.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Plant height max0.305 m

Seed mass0.813 mg

Seed mass max0.813 mg

Seed mass min0.813 mg

Life cycle & reproduction3

Life formannual or subshrub

Life spanperennial

⚠ sources differ — AusTraits: perennial · GIFT: annual

Raunkiær life formtherophyte

Habitat & environment5

Climateseasonally dry tropical

Climberself-supporting

Growth formherb

Mycorrhiza type0.0000122

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indigofera cordifolia has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences5

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP818975.1 ↗528 bpIndia

ACGT

CTGCGGAGGATCATTGTCGTTGCCTTACAAGCAATCAGACTCGTGAACATGTTTTCTTACTTTTGGTTGGTTTGGAGTGTGTAAACACTC …

Indigofera cordifolia voucher MSoLS_IC_R14 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Indigofera cordifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–282n range16median16mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 169×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn67-71 +4

CCDB · ipcn-api-dl — Yadava, K. S. & A. K. Singh. 1980. Cytomorphological studies in semi-arid species of Indigofera L. Bull. Bot. Soc. Bengal 34: 95–102.

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · book-ipcn66 — Frahm-Leliveld 1966

CCDB · book-ipcn67-71 — SINGH, A., & R.P. ROY. 1970. Karylogical studies in Triqonella, Indiqofera, and Phaseolus. Nucleus 13: 41-54.

CCDB · book-ipcn75-78 — Bir & Kumari 1977

CCDB · book-ipcn73-74 — BHATT, R.P. 1974. Studies on the flora in north Gujarat. III Cytolog I Nucleus 17: 33-39. !

CCDB · book-indian_vol1 — Ramanathan, K. 195 5b ; Bir, S.S. & Sidhu, S. 1966 ; Frahm-Leliveld, J.A. 1966; Singh, A. & Roy, R.P. 1970; Bhatt, R.P. 1974; Sanjappa, M. & Bhatt, R.P. 1976; Singh, A.K. & Yadava, K.S. 1978b

CCDB · eflora

2n 281×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Bir, S.S. & Sidhu, S. 1967

n 86×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1979. Cytological observations in the family Fabaceae: tribe Indigofereae. J. Cytol. Genet. 14: 58–63.

CCDB · ipcn-api-dl — Jahan, B., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in some taxa of Fabaceae mostly native to Pakistan. Ann. Missouri Bot. Gard. 81: 792–799.

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.

CCDB · ipcn-api-dl — Bir, S. S. & S. Kumari. 1977. Evolutionary status of Leguminosae from Pachmarhi, central India. Nucleus 20: 94–98.

CCDB · book-ipcn75-78 — Bir & Kumari 1977

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1976

n 142×CCDB · book-ipcn66 · CCDB · book-ipcn67-71

CCDB · book-ipcn66 — Bir & Sidhu 1966

CCDB · book-ipcn67-71 — BIR, S.S. & S. SIDHU. 1967. Cytological observations on the North Indian members of family Leguminosae. Nucleus 10: 47-63.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type274 records

Wild obs. + sensor197

Museum / vouchered76

Other1

Origin

Native5

Range

Area of Occupancy AOO788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 35≤1 km 20≤10 km 4>10 km 3

62 georeferenced · 135 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 11≤1 km 5≤10 km 8>10 km 1

25 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence76

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	9
Palmerston, AU	7
Museo Entomologico de Leonlocation not on record	6
Canberra, AU	5
Dehra Dun, IN	4
MeiseBGlocation not on record	4
Berlin, DE	3
Mount Annan, AU	3
Brisbane, AU	3
Edinburgh, GB	3
Xiamen, CN	2
Saint Louis, US	2
Paris, FR	1
Gujarat Biodiversity Gene Banklocation not on record	1
Kensington, AU	1
Wlocation not on record	1
Fort Worth, US	1
SNJB's KKHA Arts, SMGL Commerce & SPHJ Science College Chandwad, Dist. Nashik, Maharashtra, India. 423101.location not on record	1
Uppsala, SE	1
Adelaide, AU	1
Smithfield, AU	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
LDlocation not on record	1

23 institutions · 62 of 76 vouchered records shown · 13 without an institution code

09Environmental DNA2 detections

Where the DNA of Indigofera cordifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 25.4–27.8

Seasonal swing summer↔winter15.2 °C

Max temp (day)30.5 °C

Min temp (night)22.1 °C 19.9–24.4

Precipitation182 mm/mo 124–241

Air humidity58.4 % 53.2–63.5

Moisture balance48.1 mm/mo -4.60–101

Vapour deficit1,477 Pa 1,366–1,588

Wind speed2.50 m/s 1.90–3.00

Cloud cover24.1 % 23.3–25.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)