Indigofera candicans — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Indigofera

At a glance

Occurrence records103

Data sources5

Biological traits14

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Indigofera candicans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF103 records

DNA & barcodingNCBIsequences

01Narrative

Indigofera candicans là một loài thực vật có hoa trong họ Đậu. Loài này được Aiton miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.05 m

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max30 m

Elevation min5 m

Epiphyteterrestrial

Growth form detailedsubshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indigofera candicans has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ350886.1 ↗810 bpSouth Africa

ACGT

CTGCCCGCGACGTTGTGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAA …

Indigofera candicans voucher BDP699 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor89

Museum / vouchered14

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 68≤1 km 8>10 km 1

77 georeferenced · 12 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	7
Cape Town, ZA	4
LDlocation not on record	2
Kew, GB	1

4 institutions · 14 of 14 vouchered records shown