Indigofera australis

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Indigofera

At a glance

Occurrence records11 959

Data sources9

Biological traits44

DNA specimens8

eDNA detections5

Sources9 archives

Databases and archives Indigofera australis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 959 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources44 traits

Occurrence & distributionGBIF11 959 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 16

01Narrative

نيلة جنوبية هو نوع من النباتات يتبع جنس النيلة من الفصيلة البقولية. سمي هذا النوع بالجنوبي نسبة إلى النصف الجنوبي للكرة الأرضية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology19

Fruit length32.5 mm

Fruit width2.5 mm

Leaf length40 mm

Leaf length max100 mm

Leaf length min40 mm

Leaf mass14.2 mg

Leaf mass per area82.37 g/m2

Leaf size283 mm²

Leaf width8.17 mm

Leaf width max9 mm

Leaf width min5 mm

Plant height2 m

⚠ sources differ — AusTraits: 2 m · TRY: 1 m

Plant height max2.5 m

Plant height min0.3 m

Seed length1.85 mm

Seed mass5.32 mg

⚠ sources differ — TRY: 5.32 mg · AusTraits: 4.6 mg · GIFT: 5.01 mg

Seed mass max6.14 mg

Seed mass min3.5 mg

Seed width1.5 mm

Life cycle & reproduction9

Dehiscencedehiscent

Dispersal typeself

Flowering timennnnnnnyynnn

Life spanperennial

Lifespan years30 years

Pollination syndromeinsect

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typehermaphrodite+monoecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Habitat GIFTdense secondary shrub and ruderal vegetation

Leaf compoundnesscompound

Leaf shapeelliptical oblong

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density614 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indigofera australis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences8

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL536523.1 ↗339 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGCCTGCCTGGGTGTCACACATC …

Indigofera australis voucher MO:Carlsen3168 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Indigofera australis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type11 959 records

Wild obs. + sensor11 323

Museum / vouchered443

Cultivated / captive7

Other186

Origin

Native10

Introduced1

Range

Area of Occupancy AOO26 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 8 642≤1 km 1 317≤10 km 317>10 km 157

10 433 georeferenced · 890 without coordinates

Open the mapobservation + sensor11 323

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 83≤1 km 91≤10 km 114>10 km 7

295 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence443

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 5 without coordinates

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	93
Armidale, AU	69
NSW Dept of Planning, Industry and Environmentlocation not on record	30
Kensington, AU	28
Kew, GB	26
Wollongong, AU	22
Palmerston, AU	21
Mount Annan, AU	16
Parkville, AU	16
Canberra, AU	15
Batemans Bay, AU	14
John T. Waterhouse Herbariumlocation not on record	10
QVMAGlocation not on record	9
Auckland, NZ	8
Smithfield, AU	7
LDlocation not on record	7
Brisbane, AU	6
La Trobe Universitylocation not on record	5
James Cook Townsvillelocation not on record	5
BGPAlocation not on record	5
Hobart, AU	4
University of Stellenboschlocation not on record	3
Stockholm, SE	3
Rotorua, NZ	2
NSW Office of Environment and Heritagelocation not on record	2
Paris, FR	2
Saint Louis, US	1
Canadian Department of Agriculturelocation not on record	1
Christchurch, NZ	1
UNICAMPlocation not on record	1
AUAlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Moscow State Universitylocation not on record	1
Beijing, CN	1
Wellington, NZ	1
EL PASO, US	1

36 institutions · 438 of 443 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Indigofera australis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.5 °C

Min temp (night)8.70 °C

Precipitation114 mm/mo

Air humidity54.5 %

Moisture balance0.9 mm/mo

Vapour deficit709 Pa

Wind speed4.00 m/s

Cloud cover44.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Indigofera australis

At a glance

Sources9 archives

Size & morphology19

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type11 959 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 36 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 959 records