Indigofera astragalina

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Indigofera

At a glance

Occurrence records876

Data sources10

Biological traits22

DNA specimens12

eDNA detections7

Sources10 archives

Databases and archives Indigofera astragalina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility876 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF876 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Indogofera astragalina, a legume also known as silky indigo, is a herb found in India, tropical Africa, Madagascar, New Guinea and Australia. It commonly grows in sandy or rocky soils in dry deciduous forests or along roadsides and lake margins. It is also cultivated.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.457 m

Plant height max1.2 m

Plant height min0.2 m

Seed mass4.75 mg

Seed mass max5.75 mg

Seed mass min3.01 mg

Life cycle & reproduction4

Dehiscencedehiscent

Life formannual or perennial

Life spanannual

Lifeform raunkiaer detailedtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 050 m

Elevation min610 m

Epiphyteterrestrial

Fruit typelegume

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indigofera astragalina has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes6

GenBank sequences3

eDNA detections7

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMH595820.1 ↗616 bpIndia · 2016

ACGT

ATATGACCCGTGAACATGTTTGCTTACTTGGGGTTGGCTTGGCGTGCGAAAGCACCCTTGCCTCCCCCGGCACAGGAGGCGGCCACGCTC …

Indigofera astragalina voucher DSM AKP 3320 DUH internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★rbcLa★trnL-F★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Indigofera astragalina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–222n range16median16mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 167×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +3

CCDB · ipcn-api-dl — GUPTA, P. K. & K. Agarwal. 1982. Cytological studies in the genus Indigofera L. Cytologia 47: 665–681.

CCDB · ipcn-api-dl — Bairiganjan, G. C. & S. N. Patnaik. 1989. Chromosomal evolution in Fabaceae. Cytologia 54: 51–64.

CCDB · book-ipcn67-71 — SINGH, A., & R.P. ROY. 1970. Karylogical studies in Triqonella, Indiqofera, and Phaseolus. Nucleus 13: 41-54.

CCDB · book-ipcn73-74 — BHATT, R.P. 1974. Studies on the flora in north Gujarat. III Cytolog I Nucleus 17: 33-39. !

CCDB · book-indian_vol1 — Frahm-Leliveld, J.A. 1960a ; Singh, A. & Roy, R.P. 1970; Bhatt, R.P. 1974 ; Sanjappa, M. & Bhatt, R.P. 1976 ; Rao, C.K. 1979 J6 Mehra, P.N. & Dhawan, H. 1971

CCDB · eflora

CCDB · book-fedorov — Frahm-Leliveld 1960a

2n 222×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.

CCDB · book-ipcn75-78 — Sanjappa & Bhatt 1976

n 83×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sanjappa, M. & R. P. Bhatt. 1979. Cytological observations in the family Fabaceae: tribe Indigofereae. J. Cytol. Genet. 14: 58–63.

CCDB · ipcn-api-dl — GUPTA, P. K. & K. Agarwal. 1982. Cytological studies in the genus Indigofera L. Cytologia 47: 665–681.

CCDB · ipcn-api-dl — Kameswara Rao, C. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 276–277.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.916 ↗

08Occurrence & distribution

Record type876 records

Wild obs. + sensor611

Museum / vouchered248

Cultivated / captive2

Other15

Range

Area of Occupancy AOO1 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 26≤1 km 3>10 km 2

31 georeferenced · 580 without coordinates

Open the mapobservation + sensor611

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 6

7 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence248

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	45
Kew, GB	43
Paris, FR	20
Frankfurt am Main	19
Saint Louis, US	15
CNF-UFHBlocation not on record	5
Xiamen, CN	5
Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record	5
HNBlocation not on record	4
MeiseBGlocation not on record	4
Instituto de Investigação Científica Tropicallocation not on record	2
Cape Town, ZA	2
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	2
Pondicherry, IN	2
South Kensington, GB	2
Centre National des Semences Forestièreslocation not on record	1
University of Stellenboschlocation not on record	1
MSB-3054location not on record	1
University of Johannesburglocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
LDlocation not on record	1
LSFlocation not on record	1
Coimbra, PT	1
Bronx, US	1

24 institutions · 184 of 248 vouchered records shown · 63 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Indigofera astragalina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

Floodplain/Thicket

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 22.9–25.7

Seasonal swing summer↔winter8.20 °C

Max temp (day)28.7 °C 28.2–31.1

Min temp (night)19.3 °C 18.1–20.1

Precipitation88.6 mm/mo 28.0–119

Air humidity58.0 % 52.3–59.1

Moisture balance-53.4 mm/mo -88.7–-29.5

Vapour deficit1,220 Pa 1,168–1,607

Wind speed2.80 m/s 1.90–2.90

Cloud cover13.5 % 8.30–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)