Indianthus virgatus

(Roxb.) Suksathan & Borchs. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Marantaceae/Indianthus

At a glance

Occurrence records17

Data sources7

Biological traits9

DNA specimens4

eDNA detections3

Sources7 archives

Databases and archives Indianthus virgatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Indianthus is a genus of plants. It contains only one species, Indianthus virgatus (Roxb.) Suksathan & Borchs, native to India, Sri Lanka and the Andaman Islands.Kew World Checklist of Selected Plant Families, IndianthusSuksathan & Borchs., Bot. J. Linn. Soc. 159: 393 (2009).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formrhizomatous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Indianthus virgatus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAY914666.1 ↗230 bp

ACGT

ACTGCGGAAGGATCATTGTGGAAAACCTCGCCGAGGAGGACCGCGAATGTGTCAACCAAACGGCGTCGGGCCGGGGCACGCCCTCGGCCG …

Schumannianthus virgatus 18S ribosomal RNA gene and internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL1★ITS2★ITS2

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type17 records

Wild obs. + sensor7

Museum / vouchered10

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 3>10 km 1

6 georeferenced · 1 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	7
Xiamen, CN	2
McWane Science Centerlocation not on record	1

3 institutions · 10 of 10 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Indianthus virgatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)