Incarvillea delavayi

Bureau & Franch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Bignoniaceae/Incarvillea

At a glance

Occurrence records65

Data sources12

Biological traits9

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Incarvillea delavayi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Chemical compositionLOTUS30 compounds

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Incarvillea delavayi, the socalled hardy gloxinia or flowering fern, is a species of flowering plant in the family Bignoniaceae, native to western Sichuan and northwest Yunnan provinces of China. The true Gloxinia are members of the Gesneriaceae, while true ferns are flowerless plants which reproduce through spores. A slugprone perennial with fernlike leaves, it is hardy in USDA zones 5b through 7, and is recommended for borders and rock gardens in part shade to full sun. The original species and a number of cultivars are commercially available, including 'Bees Pink' and 'Snowtop'.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass3.91 mg

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth form detailedherb

Woodinessnon-woody

03Chemical composition30 compounds

Compounds documented for Incarvillea delavayi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives6

Stigmastane steroids3

Ursane and Taraxastane triterpenoids2

Iridoids monoterpenoids2

Flavonols2

Documented compounds30 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(1R,2S,3S,4aS,5R)-3-[(2R)-1,2-dihydroxypropan-2-yl]-4a,5-dimethyl-2,3,4,5,6,7-hexahydro-1H-naphthalene-1,2-diol	present	LOTUS
(1R,3S,4S,8R,11R,12S,16R)-4-hydroxy-2,7,17-trioxapentacyclo[10.7.0.01,16.03,11.04,8]nonadecane-10,14-dione	present	LOTUS
(1R,4aS,5R,7R,7aR)-1-ethoxy-5-hydroxy-7-methyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carbaldehyde	present	LOTUS
(1S)-6-hydroxy-1-methyl-2,3-dihydro-1H-indene-4-carbaldehyde	present	LOTUS
(2s,6r)-2,6-Dimethyl-1,8-octanediol	present	LOTUS
2-(1,4-Dihydroxycyclohexyl)ethyl 3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
2-Propenoic acid, 3-(3,4-dihydroxyphenyl)-, ethyl ester	present	LOTUS
4-Coumaric acid	present	LOTUS
4-Hydroxy-3-methylbenzoic acid	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Incarvillea delavayi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY695860.1 ↗623 bp

ACGT

TCGTAACCTGCAAAGCAGACCGTGAACATGTTTTTAACACCGGGGGAATCGGCGTGGCGGGAGACCTCCCGCCGTGAACCCTTCCTGCTG …

Incarvillea delavayi internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Incarvillea delavayi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records18–222n range22median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 224×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Xiao, H., Q.-x.Zhou, Z. j. Gu & K. y. Guan. 2002. Karyomorphology of six Incarvillea species. Acta Bot. Yunnan. 24(1): 87–93.

CCDB · ipcn-api-dl — Chen, S. t. 2004. Karyomorphology of Incarvillea (Bignoniaceae) and its implications in distribution and taxonomy. Bot. J. Linn. Soc. 144: 113–121.

CCDB · book-fedorov — Bowden 1940a

CCDB · book-atlas-flowering-plants — Sugiura 1940a

2n 181×CCDB · book-fedorov

CCDB · book-fedorov — Sugiura 1931, 1936a, b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type65 records

Wild obs. + sensor4

Museum / vouchered59

Cultivated / captive2

Origin

Introduced1

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 2

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1≤10 km 1

3 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence59

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	19
Beijing, CN	10
Chengdu, CN	8
Xining, CN	7
Guangzhou, CN	3
Strecker Museum, Baylor Universitylocation not on record	2
Oskarshamn, SE	1
WTUlocation not on record	1
Yangling, CN	1
Nijmegen, NL	1
Christchurch, NZ	1
Chongqing Natural History Museumlocation not on record	1
GMBAlocation not on record	1
ASUlocation not on record	1

14 institutions · 57 of 59 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Incarvillea delavayi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)