Impatiens morsei — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Ericales/Balsaminaceae/Impatiens

At a glance

Occurrence records46

Data sources6

Biological traits4

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Impatiens morsei's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF46 records

DNA & barcodingNCBIsequences

01Narrative

Impatiens morsei is a species of flowering plant in the family Balsaminaceae. It is endemic to China, where it only occurs in Guangxi.Impatiens morsei. Flora of China. It is an annual plant with a succulent, purplish stem growing up to a meter tall. It produces white, pink, or purple flowers with orange throats. It grows in moist, shady habitat such as forest understory.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass7.5 mg

Life cycle & reproduction1

Life formannual

Habitat & environment1

Climatesubtropical

Other traits1

Plant support typefree-standing

05DNA & barcoding5 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Impatiens morsei has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP776086.1 ↗643 bp

ACGT

TCGAGAGCTATACTTAAAACAACCAGAGAACATGTCAAATATTAATAACCTTAGGCGTGATTGGCCTTGGCCGGTCCCTTCCTATCCTGC …

Impatiens morsei voucher S.X. Yu 3127 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL3ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor1

Museum / vouchered45

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 45 records without

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	13
Guilin, CN	12
Guangzhou, CN	8
Kunming, CN	4
Beijing, CN	4
Taipei, TW	4

6 institutions · 45 of 45 vouchered records shown