Impatiens jerdoniae

Wight · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ericales/Balsaminaceae/Impatiens

At a glance

Occurrence records2

Data sources7

Biological traits3

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Impatiens jerdoniae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 20

01Narrative

Impatiens jerdoniae is a species of flowering plant in the family Balsaminaceae. It is native to the Western Ghats of India. It was described and named by Robert Wight and commemorates Flora Jerdon, wife of Thomas C. Jerdon. It grows on rocks and as an epiphyte on trees.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction1

Life formepiphytic subshrub

Habitat & environment2

Climatewet tropical

Growth formherb

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Impatiens jerdoniae has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKT225492.1 ↗425 bpIndia · 2012

ACGT

ATTGTTAATTAAAATGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGC …

Impatiens jerdoniae isolate IMP 18 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Impatiens jerdoniae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Zinov'eva-Stahevitch, A. E. & W. F. Grant. 1984. Chromosome numbers in Impatiens (Balsaminaceae). Canad. J. Bot. 62: 2630–2635.

CCDB · ipcn-api-dl — Zinov'eva-Stahevitch, A. E. & W. F. Grant. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 365–366.

CCDB · book-indian_vol1 — Bhaskar, V. 1976

n 101×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — BHASKAR, V. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.931 ↗

08Occurrence & distribution

Record type2 records

Wild obs. + sensor2

Range

Area of Occupancy AOO8 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)