Impatiens capensis
Meerb. · speciesAt a glance
Occurrence records96 716
Data sources14
Biological traits107
DNA specimens71
eDNA detections201
Sources14 archives
Databases and archives Impatiens capensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility96 716 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI201 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics71 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources107 traits
Chemical compositionLOTUS · NPASS21 compounds
Occurrence & distributionGBIF96 716 records
Environmental DNA2 datasets · 7 countries201 detections
DNA & barcodingBOLD · NCBI71 specimens
Genome at a glanceCCDB · GoaT822 Mbp
01Narrative
L'Impatiente du Cap est une espèce de plantes à fleurs de la famille des Balsaminaceae. Cette fleur est aussi connu sous le nom du Balsamine du Cap. L'Impatiente du Cap est une plante originaire d'Amérique du Nord, qui pousse dans les sites ombragés et humides tels que les bords de rivières ou de ruisseaux. Les impatientes du Cap ont tendance à former des grandes colonies. C'est une plante annuelle de 1 m de haut. Ses inflorescences sont formées de fleurs orange. Le fruit est une capsule allongée, bosselée et verte qui mesure 2 cm de longueur qui contient de quatre à six graines.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology7
Leaf size1 943 mm²
Plant height0.9 m
⚠ sources differ — GIFT: 0.9 m · LEDA: 0.3 m · USDA: 1.49 m · TRY: 0.42 m
Plant height max1.5 m
Plant height min0.5 m
Seed mass6.94 mg
⚠ sources differ — TRY: 6.94 mg · GIFT: 4.2 mg
Seed mass max7.76 mg
Seed mass min7.76 mg
Life cycle & reproduction30
After harvest regrowth rateSlow
Bloom periodIndeterminate
Coppice potentialNo
Deciduousnessevergreen
Dehiscencedehiscent
Dispersal typehuman
Flower colouryellow
Flower conspicuousNo
Flowering endOct
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formannual
Life spanannual
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Seed number4
Seed spread rateSlow
Seedling vigorHigh
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSummer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typecapsule
Growth formherb
Growth form USDASingle Crown
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min14 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceLow
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min95 days
Leaf C:N ratio31.2 g/g
Leaf c447 mg/g
Leaf dry-matter content (LDMC)104 mg/g
Leaf n14.45 mg/g
Leaf p2.9 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min14 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceLow
Soil pH max7.4 pH
Soil pH min6.4 pH
Specific leaf area (SLA)45.84 mm²/mg
⚠ sources differ — TRY: 45.84 mm²/mg · LEDA: 54.3 mm²/mg · GIFT: 54.3 mm²/mg
Temperature min32 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound700 000 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
03Chemical composition21 compounds
Compounds documented for Impatiens capensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones6
Plant xanthones5
Secoiridoid monoterpenoids3
Iridoids monoterpenoids2
Acyl phloroglucinols1
Documented compounds21 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Sweroside | present | NPASS | |
| (1R,4aS,6S,7R,7aS)-1,6-dihydroxy-7-methyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid | present | NPASS | |
| (3S,4R,4aS,5R)-4-ethenyl-5-methoxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,4a,5,6-tetrahydro-3H-pyrano[3,4-c]pyran-8-one | present | NPASS | |
| (3S,4R,4aS,5S)-4-ethenyl-5-methoxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4,4a,5,6-tetrahydro-3H-pyrano[3,4-c]pyran-8-one | present | NPASS | |
| (4-hydroxy-2,6-dimethoxyphenyl)-[3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]methanone | present | NPASS | |
| (7Alpha-Hydroxy)-Morroniside | present | NPASS | |
| 1,3,6,8-tetrahydroxy-2-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]xanthen-9-one | present | NPASS | |
| 1,8-dihydroxy-5,6-dimethoxy-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxyxanthen-9-one | present | NPASS | |
| 2,6,8-trihydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyxanthen-9-one | present | NPASS | |
| 2,6,8-trihydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]oxan-2-yl]oxyxanthen-9-one | present | NPASS |
05DNA & barcoding71 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Impatiens capensis has left across the world's sequence archives.
At a glance
DNA specimens71
Marker genes9
GenBank sequences10
eDNA detections201
Countries7
The DNA barcodea real sequence read deposited for this species
CAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGCGTCTCGCTTCGT …
Impatiens capensis isolate CJW 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL6★rbcLa★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Impatiens capensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size821 520 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Impatiens capensis0.82 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records14–202n range20median20mode14records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2012×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Zinov'eva-Stahevitch, A. E. & W. F. Grant. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 365–366.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2008. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 3. Kochia 3: 55–60.
CCDB · ipcn-api-dl — Zinov'eva-Stahevitch, A. E. & W. F. Grant. 1984. Chromosome numbers in Impatiens (Balsaminaceae). Canad. J. Bot. 62: 2630–2635.
CCDB · ipcn-api-dl — Govindarajan, T. & D. Subramanian. 1986. Karyotaxonomy of south Indian Balsaminaceae. Cytologia 51: 107–116.
CCDB · ipcn-api-dl — Rao, R. V. S., K. R. Ayyangar & R. Sampathkumar. 1986. On the karyological characteristics of some members of Balsaminaceae. Cytologia 51: 251–260.
CCDB · book-ipcn73-74 — RAO, R.V.S. 1973. Further studies on the cytology of south Indian Balsaminaceae. Proc. Indian Sci. Congr. Assoc. 60(III): 317.
CCDB · book-fedorov — Smith F. H. 1934
CCDB · book-fedorov — Khoshoo 1955a, 1966
CCDB · book-atlas-flowering-plants — F. H. Smith 1934
2n 142×CCDB · nw-europe-fl · CCDB · book-fedorov
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3216
CCDB · book-fedorov — Wulff (T. 1936)
n 109×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +3
CCDB · book-ipcn65 — DeLisle 1965
CCDB · book-ipcn65 — Bostick 1965
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — BHASKAR, V. 1976. In IOPB chromosome number reports LI. Taxon 25: 155–164.
CCDB · book-ipcn66 — Khoshoo 1966
CCDB · book-ipcn73-74 — CHINNAPPA, C.C., & L.S. GILL. 1974. Chromosome numbers from pollen in some North American Impatiens (Balsaminaceael. Canad. J. Bot. 52: 2637-2639.
CCDB · Cave1958 — Khoshoo '57
CCDB · Cave1959 — Khoshoo 1955b
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.995 ↗
08Occurrence & distribution
Record type96 716 records
Wild obs. + sensor91 382
Museum / vouchered5 249
Cultivated / captive74
Other11
Origin
Native38
Introduced1 262
Range
Area of Occupancy AOO159 592 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 51 291≤1 km 10 113≤10 km 13 238>10 km 3 248
77 890 georeferenced · 13 492 without coordinates
Open the mapobservation + sensor91 382
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 292≤1 km 1 012≤10 km 1 766>10 km 226
3 296 georeferenced · 1 953 without coordinates
Open the institutions mapphysical evidence5 249
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 74 records without
Open the mapnot free-living74
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions127 of 206 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Madison, US | 536 |
| Philadelphia, US | 442 |
| Chongqing Museumlocation not on record | 403 |
| St. Paul, US | 295 |
| Chicago, US | 174 |
| Wuzhou, CN | 171 |
| Oregon State Universitylocation not on record | 171 |
| Bloomington, US | 132 |
| Québec, CA | 128 |
| WTUlocation not on record | 119 |
| University of Wisconsinlocation not on record | 115 |
| University of New Hampshirelocation not on record | 100 |
| Acadia Universitylocation not on record | 99 |
| Allentown, US | 98 |
| Ann Arbor, US | 92 |
| Saint Louis, US | 74 |
| WINlocation not on record | 73 |
| Montréal, CA | 68 |
| Williamsburg, US | 64 |
| Millersville, US | 60 |
| Burlington, US | 57 |
| Saint John, CA | 57 |
| Université Lavallocation not on record | 56 |
| University of Stellenboschlocation not on record | 52 |
| Green Bay, US | 49 |
| McWane Science Centerlocation not on record | 48 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 46 |
| Bronx, US | 42 |
| Bangkok, TH | 40 |
| College Park, US | 38 |
| University of Alberta Museumslocation not on record | 35 |
| Toronto, CA | 31 |
| Jackson, US | 29 |
| Helsinki, FI | 25 |
| Chapel Hill, US | 25 |
| South Kensington, GB | 24 |
| Vancouver, CA | 24 |
| Dekalb, US | 24 |
| Columbia, US | 23 |
| Corvallis, US | 22 |
| Chadron, US | 22 |
| Uniwersytet Wrocławskilocation not on record | 21 |
| Pullman, US | 20 |
| Morgantown, US | 20 |
| Norfolk, US | 20 |
| Lincoln, US | 19 |
| Victoria, CA | 18 |
| Whitewater, US | 17 |
| University of Wisconsinlocation not on record | 16 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 16 |
| Western Carolina Universitylocation not on record | 15 |
| Fayetteville, US | 15 |
| Chicago, US | 15 |
| BAYLUlocation not on record | 14 |
| Dover, US | 14 |
| Fredericksburg, US | 13 |
| Flagstaff, US | 13 |
| China Agricultural Universitylocation not on record | 13 |
| Moscow, US | 12 |
| Hudson, US | 11 |
| Mississippi State, US | 11 |
| Fairfax, US | 11 |
| Austin, US | 11 |
| GAlocation not on record | 10 |
| Knoxville, US | 10 |
| Pittsburg, US | 9 |
| Asheville, US | 9 |
| Museum of the Rockieslocation not on record | 9 |
| Tacoma, US | 9 |
| Portland, US | 9 |
| Keene State Universitylocation not on record | 9 |
| New Haven, US | 9 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 9 |
| AUAlocation not on record | 9 |
| University of Tennessee at Chattanoogalocation not on record | 8 |
| Tuscaloosa, US | 8 |
| Macomb, US | 8 |
| Emporia, US | 8 |
| San Angelo, US | 8 |
| GB | 8 |
| Ypsilanti, US | 8 |
| Riverside, US | 8 |
| Harrisonburg, US | 7 |
| Philadelphia, US | 7 |
| Lord Fairfax Community Collegelocation not on record | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| Denver, US | 7 |
| Spearfish, US | 7 |
| Clemson, US | 7 |
| Boise, US | 7 |
| Claremont, US | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 6 |
| Richmond, US | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 6 |
| Smithsonian Institutionlocation not on record | 6 |
| Fargo, US | 6 |
| Henderson State Universitylocation not on record | 6 |
| Jefferson City, US | 5 |
| Whitehorse, CA | 5 |
| Brookings, US | 5 |
| Cincinnati, US | 5 |
| Moscow State Universitylocation not on record | 5 |
| MeiseBGlocation not on record | 5 |
| US | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Kunming, CN | 4 |
| Phoenix, US | 4 |
| Trois-Rivières, CA | 4 |
| Tampa, US | 4 |
| Chicago, US | 4 |
| Hamilton, US | 4 |
| Kew, GB | 4 |
| Mount Pleasant, US | 4 |
| Northridge, US | 4 |
| Conway, US | 4 |
| Kirksville, US | 4 |
| Springfield, US | 4 |
| Johnson City, US | 4 |
| Tennessee Technological Universitylocation not on record | 3 |
| Beijing, CN | 3 |
| San Jose, US | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Logan, US | 3 |
| Oswego, US | 3 |
| Provo, US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Tempe, US | 3 |
| Washington, US | 3 |
| Dresden, DE | 3 |
| Paris, FR | 3 |
| Conway, US | 3 |
| Nijmegen, NL | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Durham, US | 3 |
| UFPRlocation not on record | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Little Rock, US | 3 |
| CJBNlocation not on record | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Baltimore, US | 2 |
| Edmonton, CA | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Lubbock, US | 2 |
| Decorah, US | 2 |
| Fort Worth, US | 2 |
| Kingston, US | 2 |
| Cheney, US | 2 |
| Pocatello, US | 2 |
| Caldwell, US | 2 |
| BClocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| CONCOLlocation not on record | 2 |
| Turku, FI | 2 |
| DBF-NHMDlocation not on record | 2 |
| San Luis Obispo, US | 1 |
| Edinburgh, GB | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Jaén, ES | 1 |
| Durham, US | 1 |
| Frankfurt am Main | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Minia, EG | 1 |
| Olocation not on record | 1 |
| Salamanca, ES | 1 |
| Oulu, FI | 1 |
| Wlocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Portland, US | 1 |
| Oskarshamn, SE | 1 |
| University of Lethbridgelocation not on record | 1 |
| Bothell, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| EL PASO, US | 1 |
| TUR-Alocation not on record | 1 |
| MAlocation not on record | 1 |
| Minot State Universitylocation not on record | 1 |
| Long Beach, US | 1 |
| Chiba, JP | 1 |
| Waverly, US | 1 |
| Bourges, FR | 1 |
| Montréal, CA | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| McGill University, Department of Biologylocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| GZUlocation not on record | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| València, ES | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| Mlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| LINUlocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Santa Barbara, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
206 institutions · 5 020 of 5 249 vouchered records shown · 228 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA201 detections
Where the DNA of Impatiens capensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found201
Studies independent surveys2
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 201 detections have coordinates
Open the map7 countries0
Northern temperate standDisturbed edges of Betula alleghaniensis / A…Lakeshore.river shoreManaged boreal mixedwood stand
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.6 °C 11.6–19.6
Seasonal swing summer↔winter22.7 °C
Max temp (day)19.8 °C 15.7–24.4
Min temp (night)12.7 °C 6.60–15.5
Precipitation78.6 mm/mo 58.4–99.4
Air humidity59.7 % 58.2–61.4
Moisture balance-42.3 mm/mo -74.7–3.70
Vapour deficit700 Pa 571–931
Wind speed3.30 m/s 2.30–5.60
Cloud cover38.5 % 36.5–45.3
CHELSA 1981–2010, ~9 km grid, at location & month of 101 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.