Illicium parviflorum

Michx. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Austrobaileyales/Schisandraceae/Illicium

At a glance

Occurrence records126

Data sources14

Biological traits16

DNA specimens6

eDNA detections3

Sources14 archives

Databases and archives Illicium parviflorum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF126 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT12.6 Gbp

01Narrative

Illicium parviflorum, commonly known as yellow anisetree, yellow-anise, swamp star-anise,Illicium parviflorum. Flora of North America. and small anise tree,Illicium parviflorum. Missouri Botanical Garden. is a species of flowering plant in the family Schisandraceae, or alternately, the Illiciaceae. It is native to Florida in the United States. It historically occurred in Georgia as well, but it has been extirpated from the state.Illicium parviflorum. NatureServe. 2012.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height4.57 m

Seed mass8.08 mg

Seed mass max8.08 mg

Seed mass min8.08 mg

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition11 compounds

Compounds documented for Illicium parviflorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Prezizaane sesquiterpenoids6

Monomeric stilbenes2

Flavanones2

Cinnamic acids and derivatives $ Neolignans1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,2R,5R,6S,10R,13R)-5,10,13-trihydroxy-2,6,13-trimethyl-8-oxatricyclo[4.4.3.01,5]tridecane-9,12-dione	present	LOTUS
(1S,2R,5R,6S,8R,10S,13R,14R)-1,5,13-trimethyl-9,11-dioxatetracyclo[6.4.1.16,10.02,6]tetradecane-2,8,13,14-tetrol	present	LOTUS
(1S,2R,6R,7R,8S,10R,13R)-2,7,8-trihydroxy-6,7,13-trimethyl-4,9-dioxatetracyclo[6.5.1.01,10.06,10]tetradecan-3-one	present	LOTUS
(1S,2R,6R,7R,8S,10R,13S)-2,7,8-trihydroxy-6,7,13-trimethyl-4,9-dioxatetracyclo[6.5.1.01,10.06,10]tetradecan-3-one	present	LOTUS
(2S)-5-hydroxy-7-methoxy-6-(3-methylbut-2-enyl)-2-phenyl-2,3-dihydrochromen-4-one	present	NPASS
1,3-dimethoxy-2-(3-methylbut-2-enyl)-5-[(E)-2-phenylethenyl]benzene	present	NPASS
3,5-Dimethoxy-4-prenylstilbene	present	NPASS
6-Prenylpinocembrin	present	NPASS
Pseudo-anisatin	present	LOTUS
Pseudoanisatin	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Illicium parviflorum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL536522.1 ↗349 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCACCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCACCAGGCCAAGGGCACGCCTGCCTGGGCGTCACGCTTT …

Illicium parviflorum voucher MO:Carlsen3278 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS3★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT

The complete instruction manual Illicium parviflorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size12 625 980 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Illicium parviflorum12.63 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy2× diploid · measured

Chromosome records28–282n range28median28mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 282×GoaT · Kew Plant DNA C-values Database · CCDB · eflora

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · eflora

n 141×CCDB · book-ipcn65

CCDB · book-ipcn65 — Stone 1965

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type126 records

Wild obs. + sensor93

Museum / vouchered32

Other1

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤100 m 5>10 km 88

93 georeferenced

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 3>10 km 9

12 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	12
Miami, US	10
Bronx, US	3
Montréal, CA	2
Wuzhou, CN	1
Beijing, CN	1
Tall Timbers Research Stationlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

8 institutions · 31 of 32 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Illicium parviflorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 23.7–23.7

Seasonal swing summer↔winter26.3 °C

Max temp (day)28.8 °C

Min temp (night)19.0 °C

Precipitation125 mm/mo

Air humidity57.0 %

Moisture balance-45.8 mm/mo

Vapour deficit1,258 Pa

Wind speed2.90 m/s

Cloud cover36.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)