Iliamna remota

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Iliamna

At a glance

Occurrence records72

Data sources11

Biological traits2

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Iliamna remota's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility72 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF72 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 66

01Narrative

Iliamna remota, commonly known as the Kankakee mallow, is an endangered species of flowering plant in the mallow family. It is endemic to a single location, the 700 m Langham Island in Kankakee River State Park, in the US state of Illinois.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatetemperate

03Chemical composition1 compounds

Compounds documented for Iliamna remota across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cadinane sesquiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Gossypol		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iliamna remota has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences5

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF271197.1 ↗675 bp

ACGT

TCGAAACCTGCCTAGCAGAATGACCCGTGAACGTGATATTGAACAACTCAACGAGGGGGTGCGGAAGCATACTTGCCCCAAACCCCCTCG …

Iliamna remota isolate 3Illinois internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iliamna remota carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 66 n = 33

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 331×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BATES, D.M. 1967a. Chromosome numbers in the Malvales I. Gentes Herbarium 10: 39-46.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type72 records

Wild obs. + sensor57

Museum / vouchered15

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 57

57 georeferenced

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 2

4 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	4
Bronx, US	3
Museum of the Rockieslocation not on record	2
Burlington, US	1
Norfolk, US	1
Dekalb, US	1

6 institutions · 12 of 15 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Iliamna remota was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)